Incidental Mutation 'R6351:Kcnt2'
ID514208
Institutional Source Beutler Lab
Gene Symbol Kcnt2
Ensembl Gene ENSMUSG00000052726
Gene Namepotassium channel, subfamily T, member 2
SynonymsE330038N15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6351 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location140246158-140612067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140375112 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 130 (N130I)
Ref Sequence ENSEMBL: ENSMUSP00000112887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119786
AA Change: N130I

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: N130I

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.6e-15 PFAM
Pfam:BK_channel_a 422 476 2.3e-16 PFAM
low complexity region 598 613 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120709
AA Change: N130I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: N130I

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.7e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
low complexity region 749 764 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120796
AA Change: N130I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: N130I

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
Meta Mutation Damage Score 0.6911 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 99% (95/96)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik C T 19: 11,142,401 G14D probably damaging Het
4932438A13Rik G A 3: 36,908,228 A493T probably damaging Het
Acaa1a C A 9: 119,341,564 S17* probably null Het
Adamts16 T A 13: 70,836,203 S114C probably damaging Het
Agpat5 T C 8: 18,846,708 V50A probably benign Het
Agrn T C 4: 156,179,434 N124S probably benign Het
AI481877 T C 4: 59,069,317 D703G probably benign Het
Ak8 T C 2: 28,735,626 I227T probably benign Het
Akap6 A G 12: 53,142,025 E2074G probably damaging Het
Apc T A 18: 34,312,212 S702R probably damaging Het
Ascc3 T C 10: 50,720,673 I1233T probably damaging Het
Asphd2 A T 5: 112,385,832 F318I probably damaging Het
Bnc2 T C 4: 84,293,143 T397A probably benign Het
Bpifb4 C T 2: 153,957,134 T528I probably damaging Het
Brinp3 A G 1: 146,901,585 E590G probably damaging Het
Ccdc149 A G 5: 52,385,135 S372P probably benign Het
Cdhr2 A G 13: 54,726,776 H887R probably benign Het
Clcn6 C T 4: 148,017,500 V376I probably benign Het
Cntln T G 4: 85,115,354 C1305W probably damaging Het
Cspg4 A G 9: 56,892,644 D1564G probably benign Het
Cux1 A T 5: 136,309,792 S582T probably damaging Het
Cwh43 G A 5: 73,411,905 A97T possibly damaging Het
Dsc1 A T 18: 20,086,769 F781L probably damaging Het
Dsc3 G T 18: 19,966,291 H723N probably benign Het
Ear10 A T 14: 43,923,055 V105D probably damaging Het
Ecel1 A G 1: 87,149,509 V659A possibly damaging Het
Eogt A T 6: 97,120,194 F316I probably damaging Het
Etaa1 T C 11: 17,947,188 N310D possibly damaging Het
Exoc3l2 G A 7: 19,469,708 R75Q possibly damaging Het
Fam186a A C 15: 99,941,742 L2207R probably damaging Het
Fam187b T C 7: 30,977,599 Y178H probably damaging Het
Fat1 A T 8: 45,033,495 Q3362L probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fsip2 G A 2: 82,992,684 V6254I possibly damaging Het
Gabra5 T C 7: 57,413,780 T299A probably damaging Het
Gbp11 T C 5: 105,327,598 T295A probably benign Het
Glcci1 C T 6: 8,573,203 Q44* probably null Het
Gpc5 A T 14: 115,399,200 T432S probably benign Het
Grhl1 G A 12: 24,584,858 E228K probably damaging Het
Hyal5 T C 6: 24,891,709 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints9 A G 14: 64,993,007 I128V probably damaging Het
Krba1 T C 6: 48,414,128 V717A probably benign Het
Lrp12 T A 15: 39,878,188 D377V probably damaging Het
Magi1 G T 6: 93,943,229 D135E possibly damaging Het
Map10 T A 8: 125,671,245 L459Q probably damaging Het
Mitf A G 6: 98,003,912 D238G possibly damaging Het
Mylk G T 16: 34,921,971 R951L probably benign Het
Nacad T A 11: 6,599,235 D1272V probably damaging Het
Nacad T A 11: 6,600,165 K1009* probably null Het
Ncor1 T C 11: 62,373,298 D786G probably benign Het
Oas2 G A 5: 120,748,538 R188C probably benign Het
Odf2l A G 3: 145,135,718 I300V probably benign Het
Olfr1502 A G 19: 13,861,822 T10A probably benign Het
Olfr338 T A 2: 36,377,196 V140D possibly damaging Het
Olfr484 A G 7: 108,124,430 S278P probably damaging Het
Olfr624 A G 7: 103,670,956 I25T possibly damaging Het
Olfr64 A T 7: 103,893,135 L200* probably null Het
Pes1 T A 11: 3,978,865 D574E probably benign Het
Phf20 C T 2: 156,294,210 R650C possibly damaging Het
Pias4 G A 10: 81,157,264 T248I probably damaging Het
Pkhd1 T C 1: 20,211,951 T2889A probably benign Het
Plcxd1 C A 5: 110,102,167 probably null Het
Plekha7 A G 7: 116,176,898 F194L probably damaging Het
Plxnb2 T C 15: 89,157,770 N1642S possibly damaging Het
Pnpla7 A T 2: 25,011,564 D534V probably damaging Het
Ppp2r5c A T 12: 110,554,879 S279C probably damaging Het
Ptprq T A 10: 107,708,668 T334S probably damaging Het
Rab39 T C 9: 53,686,521 D148G probably benign Het
Reep3 A T 10: 67,034,653 F121L probably benign Het
Reln G T 5: 21,901,663 C3236* probably null Het
Rrp8 C T 7: 105,734,809 C162Y probably damaging Het
Scrib C A 15: 76,064,986 Q399H possibly damaging Het
Sertad1 T A 7: 27,489,799 Y182N possibly damaging Het
Sfrp5 A G 19: 42,201,824 V63A possibly damaging Het
Slc46a1 T C 11: 78,467,159 M346T probably benign Het
Sycp2 A G 2: 178,363,416 L886S probably damaging Het
Teddm1b A T 1: 153,874,759 I105F probably benign Het
Thumpd1 A T 7: 119,720,605 I46N possibly damaging Het
Tmod4 A G 3: 95,127,853 N223S probably damaging Het
Tnfrsf10b G C 14: 69,773,401 C85S probably damaging Het
Tox T C 4: 6,697,439 T455A probably benign Het
Tox T C 4: 6,741,536 Q148R probably benign Het
Trp53bp1 A C 2: 121,269,945 S109R probably damaging Het
Tshz2 A T 2: 169,884,968 T26S probably benign Het
Tubb4a T A 17: 57,081,016 N337Y probably damaging Het
Tubb6 T A 18: 67,401,388 V119E probably damaging Het
Unk C T 11: 116,054,946 T481I probably benign Het
Vmn2r112 C T 17: 22,601,278 T44I probably benign Het
Vstm5 G A 9: 15,257,533 G131D probably damaging Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp369 T A 13: 65,296,230 S396T possibly damaging Het
Zfp932 T A 5: 110,009,343 C302* probably null Het
Zfp972 A T 2: 177,906,935 probably null Het
Zfyve21 C A 12: 111,827,594 A212E probably benign Het
Other mutations in Kcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Kcnt2 APN 1 140523098 missense probably damaging 1.00
IGL00673:Kcnt2 APN 1 140596051 missense possibly damaging 0.60
IGL00806:Kcnt2 APN 1 140523211 missense probably damaging 1.00
IGL01135:Kcnt2 APN 1 140354555 critical splice donor site probably null 0.00
IGL01412:Kcnt2 APN 1 140570417 missense probably benign 0.02
IGL01777:Kcnt2 APN 1 140595998 missense probably benign 0.20
IGL01780:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02134:Kcnt2 APN 1 140376383 missense probably benign
IGL02350:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02357:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02481:Kcnt2 APN 1 140354561 splice site probably benign
IGL02483:Kcnt2 APN 1 140354561 splice site probably benign
IGL02866:Kcnt2 APN 1 140425248 missense probably damaging 1.00
IGL02891:Kcnt2 APN 1 140574806 missense probably damaging 1.00
IGL03007:Kcnt2 APN 1 140354507 missense possibly damaging 0.50
IGL03024:Kcnt2 APN 1 140570455 missense probably benign 0.00
IGL03231:Kcnt2 APN 1 140534002 intron probably benign
R0230:Kcnt2 UTSW 1 140246345 missense probably benign 0.00
R0367:Kcnt2 UTSW 1 140351225 missense probably damaging 1.00
R0486:Kcnt2 UTSW 1 140509480 nonsense probably null
R0543:Kcnt2 UTSW 1 140609614 missense probably damaging 1.00
R0849:Kcnt2 UTSW 1 140507762 missense probably damaging 1.00
R1123:Kcnt2 UTSW 1 140573608 missense probably damaging 1.00
R1156:Kcnt2 UTSW 1 140428855 missense probably damaging 1.00
R1425:Kcnt2 UTSW 1 140383028 missense probably damaging 1.00
R1530:Kcnt2 UTSW 1 140484232 nonsense probably null
R1546:Kcnt2 UTSW 1 140431378 missense probably benign 0.01
R1728:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1729:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1730:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1739:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1762:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1783:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1784:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1785:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1862:Kcnt2 UTSW 1 140425330 missense probably damaging 1.00
R1887:Kcnt2 UTSW 1 140584247 missense probably damaging 0.99
R1889:Kcnt2 UTSW 1 140584293 missense probably damaging 1.00
R1894:Kcnt2 UTSW 1 140425341 missense probably damaging 1.00
R2005:Kcnt2 UTSW 1 140553018 missense probably damaging 0.98
R2044:Kcnt2 UTSW 1 140375154 missense probably benign 0.14
R2115:Kcnt2 UTSW 1 140552963 missense probably damaging 1.00
R2135:Kcnt2 UTSW 1 140428813 missense probably damaging 1.00
R2201:Kcnt2 UTSW 1 140509441 missense probably damaging 1.00
R2212:Kcnt2 UTSW 1 140530800 missense probably damaging 1.00
R2267:Kcnt2 UTSW 1 140573683 splice site probably null
R2442:Kcnt2 UTSW 1 140376353 missense possibly damaging 0.59
R3121:Kcnt2 UTSW 1 140428884 missense probably damaging 0.97
R3176:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3276:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3704:Kcnt2 UTSW 1 140533968 missense probably damaging 1.00
R3944:Kcnt2 UTSW 1 140584287 missense probably damaging 1.00
R4164:Kcnt2 UTSW 1 140609630 missense probably damaging 0.97
R4201:Kcnt2 UTSW 1 140425332 missense probably damaging 0.98
R4501:Kcnt2 UTSW 1 140552980 missense probably damaging 0.99
R4502:Kcnt2 UTSW 1 140507747 missense probably damaging 0.99
R4632:Kcnt2 UTSW 1 140523148 missense possibly damaging 0.90
R4758:Kcnt2 UTSW 1 140518897 missense probably damaging 1.00
R4790:Kcnt2 UTSW 1 140354516 missense probably damaging 0.99
R4892:Kcnt2 UTSW 1 140513025 nonsense probably null
R4973:Kcnt2 UTSW 1 140609650 missense probably damaging 1.00
R5154:Kcnt2 UTSW 1 140351256 missense possibly damaging 0.94
R5296:Kcnt2 UTSW 1 140609615 missense probably damaging 1.00
R5353:Kcnt2 UTSW 1 140426901 missense probably damaging 1.00
R5605:Kcnt2 UTSW 1 140574743 missense possibly damaging 0.59
R5806:Kcnt2 UTSW 1 140509496 missense probably damaging 1.00
R5887:Kcnt2 UTSW 1 140425366 missense probably damaging 1.00
R5917:Kcnt2 UTSW 1 140533928 missense probably damaging 0.99
R5961:Kcnt2 UTSW 1 140507702 missense possibly damaging 0.82
R6123:Kcnt2 UTSW 1 140362980 missense probably damaging 1.00
R6225:Kcnt2 UTSW 1 140426923 nonsense probably null
R6248:Kcnt2 UTSW 1 140509478 missense probably damaging 1.00
R6380:Kcnt2 UTSW 1 140509584 missense probably damaging 1.00
R6532:Kcnt2 UTSW 1 140584106 missense probably damaging 0.97
R6693:Kcnt2 UTSW 1 140351227 missense probably benign 0.00
R6817:Kcnt2 UTSW 1 140246193 unclassified probably benign
R6856:Kcnt2 UTSW 1 140596004 missense probably damaging 1.00
R6944:Kcnt2 UTSW 1 140584065 missense probably benign 0.00
R6971:Kcnt2 UTSW 1 140512908 missense probably benign 0.01
R7052:Kcnt2 UTSW 1 140383047 missense probably damaging 0.99
R7138:Kcnt2 UTSW 1 140596040 missense possibly damaging 0.80
R7261:Kcnt2 UTSW 1 140354517 missense possibly damaging 0.71
R7474:Kcnt2 UTSW 1 140570478 missense possibly damaging 0.84
R7524:Kcnt2 UTSW 1 140584055 missense probably damaging 0.99
R7541:Kcnt2 UTSW 1 140376384 missense probably benign 0.09
R7558:Kcnt2 UTSW 1 140523190 missense probably damaging 0.98
R7651:Kcnt2 UTSW 1 140570461 missense probably benign 0.40
R7730:Kcnt2 UTSW 1 140518948 missense probably benign 0.34
R7875:Kcnt2 UTSW 1 140573647 missense probably damaging 1.00
R7883:Kcnt2 UTSW 1 140523150 missense probably damaging 0.99
R7958:Kcnt2 UTSW 1 140573647 missense probably damaging 1.00
R7966:Kcnt2 UTSW 1 140523150 missense probably damaging 0.99
R8040:Kcnt2 UTSW 1 140450217 missense not run
R8041:Kcnt2 UTSW 1 140609660 missense not run
X0062:Kcnt2 UTSW 1 140512991 missense possibly damaging 0.50
Z1088:Kcnt2 UTSW 1 140573646 missense probably damaging 1.00
Z1088:Kcnt2 UTSW 1 140584158 nonsense probably null
Z1176:Kcnt2 UTSW 1 140376361 missense not run
Z1177:Kcnt2 UTSW 1 140609648 missense not run
Predicted Primers PCR Primer
(F):5'- TCCTGGCGTCTTGTAAGAGTAC -3'
(R):5'- AAGTCTGAATCCATGCCTTTTAGC -3'

Sequencing Primer
(F):5'- ATACACTATGTCTGGTCTACTTTGG -3'
(R):5'- CTTACTGAGATGATGAAGGGG -3'
Posted On2018-04-27