Incidental Mutation 'R6351:Tshz2'
ID514218
Institutional Source Beutler Lab
Gene Symbol Tshz2
Ensembl Gene ENSMUSG00000047907
Gene Nameteashirt zinc finger family member 2
SynonymsMtsh2, Sdccag33l, Zfp218, teashirt2, 2900073F20Rik, Tsh2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6351 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location169633013-170071816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 169884968 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 26 (T26S)
Ref Sequence ENSEMBL: ENSMUSP00000140884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109157] [ENSMUST00000109159] [ENSMUST00000123300] [ENSMUST00000140699] [ENSMUST00000185239]
Predicted Effect probably benign
Transcript: ENSMUST00000109157
AA Change: T495S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104785
Gene: ENSMUSG00000047907
AA Change: T495S

DomainStartEndE-ValueType
coiled coil region 11 42 N/A INTRINSIC
ZnF_C2H2 216 240 1.62e0 SMART
ZnF_C2H2 276 300 7.15e-2 SMART
ZnF_C2H2 381 405 4.94e0 SMART
low complexity region 460 478 N/A INTRINSIC
low complexity region 598 613 N/A INTRINSIC
low complexity region 647 667 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
HOX 836 910 3.43e-4 SMART
ZnF_C2H2 922 944 5.34e-1 SMART
ZnF_C2H2 990 1013 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109159
AA Change: T495S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104787
Gene: ENSMUSG00000047907
AA Change: T495S

DomainStartEndE-ValueType
coiled coil region 11 42 N/A INTRINSIC
ZnF_C2H2 216 240 1.62e0 SMART
ZnF_C2H2 276 300 7.15e-2 SMART
ZnF_C2H2 381 405 4.94e0 SMART
low complexity region 460 478 N/A INTRINSIC
low complexity region 598 613 N/A INTRINSIC
low complexity region 647 667 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
HOX 836 910 3.43e-4 SMART
ZnF_C2H2 922 944 5.34e-1 SMART
ZnF_C2H2 990 1013 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123300
AA Change: T26S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118550
Gene: ENSMUSG00000047907
AA Change: T26S

DomainStartEndE-ValueType
low complexity region 41 56 N/A INTRINSIC
low complexity region 90 110 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
HOX 279 353 1.7e-6 SMART
ZnF_C2H2 365 387 2.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140699
SMART Domains Protein: ENSMUSP00000120013
Gene: ENSMUSG00000047907

DomainStartEndE-ValueType
HOX 43 117 1.7e-6 SMART
ZnF_C2H2 129 151 2.3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181446
Predicted Effect probably benign
Transcript: ENSMUST00000185239
AA Change: T26S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140884
Gene: ENSMUSG00000047907
AA Change: T26S

DomainStartEndE-ValueType
low complexity region 129 144 N/A INTRINSIC
low complexity region 178 198 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
HOX 367 441 1.7e-6 SMART
ZnF_C2H2 453 475 2.3e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the teashirt C2H2-type zinc-finger protein family of transcription factors. This gene encodes a protein with five C2H2-type zinc fingers, a homeobox DNA-binding domain and a coiled-coil domain. This nuclear protein is predicted to act as a transcriptional repressor. This gene is thought to play a role in the development and progression of breast and other types of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a transposon induced allele die in utero; cultured blastocysts fail to hatch. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik C T 19: 11,142,401 G14D probably damaging Het
4932438A13Rik G A 3: 36,908,228 A493T probably damaging Het
Acaa1a C A 9: 119,341,564 S17* probably null Het
Adamts16 T A 13: 70,836,203 S114C probably damaging Het
Agpat5 T C 8: 18,846,708 V50A probably benign Het
Agrn T C 4: 156,179,434 N124S probably benign Het
AI481877 T C 4: 59,069,317 D703G probably benign Het
Ak8 T C 2: 28,735,626 I227T probably benign Het
Akap6 A G 12: 53,142,025 E2074G probably damaging Het
Apc T A 18: 34,312,212 S702R probably damaging Het
Ascc3 T C 10: 50,720,673 I1233T probably damaging Het
Asphd2 A T 5: 112,385,832 F318I probably damaging Het
Bnc2 T C 4: 84,293,143 T397A probably benign Het
Bpifb4 C T 2: 153,957,134 T528I probably damaging Het
Brinp3 A G 1: 146,901,585 E590G probably damaging Het
Ccdc149 A G 5: 52,385,135 S372P probably benign Het
Cdhr2 A G 13: 54,726,776 H887R probably benign Het
Clcn6 C T 4: 148,017,500 V376I probably benign Het
Cntln T G 4: 85,115,354 C1305W probably damaging Het
Cspg4 A G 9: 56,892,644 D1564G probably benign Het
Cux1 A T 5: 136,309,792 S582T probably damaging Het
Cwh43 G A 5: 73,411,905 A97T possibly damaging Het
Dsc1 A T 18: 20,086,769 F781L probably damaging Het
Dsc3 G T 18: 19,966,291 H723N probably benign Het
Ear10 A T 14: 43,923,055 V105D probably damaging Het
Ecel1 A G 1: 87,149,509 V659A possibly damaging Het
Eogt A T 6: 97,120,194 F316I probably damaging Het
Etaa1 T C 11: 17,947,188 N310D possibly damaging Het
Exoc3l2 G A 7: 19,469,708 R75Q possibly damaging Het
Fam186a A C 15: 99,941,742 L2207R probably damaging Het
Fam187b T C 7: 30,977,599 Y178H probably damaging Het
Fat1 A T 8: 45,033,495 Q3362L probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fsip2 G A 2: 82,992,684 V6254I possibly damaging Het
Gabra5 T C 7: 57,413,780 T299A probably damaging Het
Gbp11 T C 5: 105,327,598 T295A probably benign Het
Glcci1 C T 6: 8,573,203 Q44* probably null Het
Gpc5 A T 14: 115,399,200 T432S probably benign Het
Grhl1 G A 12: 24,584,858 E228K probably damaging Het
Hyal5 T C 6: 24,891,709 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints9 A G 14: 64,993,007 I128V probably damaging Het
Kcnt2 A T 1: 140,375,112 N130I probably damaging Het
Krba1 T C 6: 48,414,128 V717A probably benign Het
Lrp12 T A 15: 39,878,188 D377V probably damaging Het
Magi1 G T 6: 93,943,229 D135E possibly damaging Het
Map10 T A 8: 125,671,245 L459Q probably damaging Het
Mitf A G 6: 98,003,912 D238G possibly damaging Het
Mylk G T 16: 34,921,971 R951L probably benign Het
Nacad T A 11: 6,599,235 D1272V probably damaging Het
Nacad T A 11: 6,600,165 K1009* probably null Het
Ncor1 T C 11: 62,373,298 D786G probably benign Het
Oas2 G A 5: 120,748,538 R188C probably benign Het
Odf2l A G 3: 145,135,718 I300V probably benign Het
Olfr1502 A G 19: 13,861,822 T10A probably benign Het
Olfr338 T A 2: 36,377,196 V140D possibly damaging Het
Olfr484 A G 7: 108,124,430 S278P probably damaging Het
Olfr624 A G 7: 103,670,956 I25T possibly damaging Het
Olfr64 A T 7: 103,893,135 L200* probably null Het
Pes1 T A 11: 3,978,865 D574E probably benign Het
Phf20 C T 2: 156,294,210 R650C possibly damaging Het
Pias4 G A 10: 81,157,264 T248I probably damaging Het
Pkhd1 T C 1: 20,211,951 T2889A probably benign Het
Plcxd1 C A 5: 110,102,167 probably null Het
Plekha7 A G 7: 116,176,898 F194L probably damaging Het
Plxnb2 T C 15: 89,157,770 N1642S possibly damaging Het
Pnpla7 A T 2: 25,011,564 D534V probably damaging Het
Ppp2r5c A T 12: 110,554,879 S279C probably damaging Het
Ptprq T A 10: 107,708,668 T334S probably damaging Het
Rab39 T C 9: 53,686,521 D148G probably benign Het
Reep3 A T 10: 67,034,653 F121L probably benign Het
Reln G T 5: 21,901,663 C3236* probably null Het
Rrp8 C T 7: 105,734,809 C162Y probably damaging Het
Scrib C A 15: 76,064,986 Q399H possibly damaging Het
Sertad1 T A 7: 27,489,799 Y182N possibly damaging Het
Sfrp5 A G 19: 42,201,824 V63A possibly damaging Het
Slc46a1 T C 11: 78,467,159 M346T probably benign Het
Sycp2 A G 2: 178,363,416 L886S probably damaging Het
Teddm1b A T 1: 153,874,759 I105F probably benign Het
Thumpd1 A T 7: 119,720,605 I46N possibly damaging Het
Tmod4 A G 3: 95,127,853 N223S probably damaging Het
Tnfrsf10b G C 14: 69,773,401 C85S probably damaging Het
Tox T C 4: 6,697,439 T455A probably benign Het
Tox T C 4: 6,741,536 Q148R probably benign Het
Trp53bp1 A C 2: 121,269,945 S109R probably damaging Het
Tubb4a T A 17: 57,081,016 N337Y probably damaging Het
Tubb6 T A 18: 67,401,388 V119E probably damaging Het
Unk C T 11: 116,054,946 T481I probably benign Het
Vmn2r112 C T 17: 22,601,278 T44I probably benign Het
Vstm5 G A 9: 15,257,533 G131D probably damaging Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp369 T A 13: 65,296,230 S396T possibly damaging Het
Zfp932 T A 5: 110,009,343 C302* probably null Het
Zfp972 A T 2: 177,906,935 probably null Het
Zfyve21 C A 12: 111,827,594 A212E probably benign Het
Other mutations in Tshz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Tshz2 APN 2 169885536 missense possibly damaging 0.87
IGL01973:Tshz2 APN 2 169884683 missense probably damaging 1.00
IGL02209:Tshz2 APN 2 169884764 missense probably damaging 1.00
PIT4504001:Tshz2 UTSW 2 169886051 missense probably damaging 1.00
R0084:Tshz2 UTSW 2 169884366 missense probably damaging 1.00
R1757:Tshz2 UTSW 2 169883923 missense probably benign
R1908:Tshz2 UTSW 2 169885545 missense possibly damaging 0.95
R2082:Tshz2 UTSW 2 169886215 missense probably damaging 1.00
R2256:Tshz2 UTSW 2 169886477 missense probably damaging 1.00
R2259:Tshz2 UTSW 2 169886406 missense probably benign 0.43
R2260:Tshz2 UTSW 2 169886406 missense probably benign 0.43
R2444:Tshz2 UTSW 2 169884806 missense probably benign
R3085:Tshz2 UTSW 2 169883951 missense probably benign 0.10
R3904:Tshz2 UTSW 2 169884387 missense probably damaging 1.00
R4021:Tshz2 UTSW 2 169885862 missense probably damaging 1.00
R4061:Tshz2 UTSW 2 169962325 intron probably benign
R4064:Tshz2 UTSW 2 169962325 intron probably benign
R4113:Tshz2 UTSW 2 169885530 missense probably benign 0.14
R4321:Tshz2 UTSW 2 169885545 missense possibly damaging 0.95
R4355:Tshz2 UTSW 2 169884938 missense possibly damaging 0.79
R4458:Tshz2 UTSW 2 169885088 missense probably benign 0.29
R4779:Tshz2 UTSW 2 169962681 intron probably benign
R4841:Tshz2 UTSW 2 169886247 missense probably damaging 0.98
R4945:Tshz2 UTSW 2 169883874 missense probably damaging 1.00
R5073:Tshz2 UTSW 2 169962573 intron probably benign
R5110:Tshz2 UTSW 2 169884197 missense possibly damaging 0.48
R5404:Tshz2 UTSW 2 169884320 missense probably benign 0.02
R5425:Tshz2 UTSW 2 169884024 missense probably damaging 1.00
R5473:Tshz2 UTSW 2 169883798 missense probably benign
R5587:Tshz2 UTSW 2 169884342 missense probably damaging 1.00
R5832:Tshz2 UTSW 2 169884045 missense possibly damaging 0.56
R6375:Tshz2 UTSW 2 169886019 missense probably damaging 1.00
R6478:Tshz2 UTSW 2 169884664 missense probably damaging 1.00
R6675:Tshz2 UTSW 2 169886045 missense probably damaging 1.00
R6742:Tshz2 UTSW 2 169883757 missense probably damaging 1.00
R7398:Tshz2 UTSW 2 169884174 missense probably damaging 1.00
R7722:Tshz2 UTSW 2 169885272 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGCAGTCACTGTCTGAGAC -3'
(R):5'- AGAGCCCATTGCCATAGGTG -3'

Sequencing Primer
(F):5'- TGTCTGAGACCCCAAACAGTGAG -3'
(R):5'- TTGGTGCCCTCTGAGAGC -3'
Posted On2018-04-27