Incidental Mutation 'R6351:Cntln'
ID 514228
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R6351 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 85033591 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tryptophan at position 1305 (C1305W)
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000107190] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably damaging
Transcript: ENSMUST00000047023
AA Change: C1306W

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: C1306W

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107190
AA Change: C171W

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102808
Gene: ENSMUSG00000038070
AA Change: C171W

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
Blast:HisKA 135 191 8e-27 BLAST
low complexity region 192 213 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169371
AA Change: C1305W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: C1305W

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a C A 9: 119,170,630 (GRCm39) S17* probably null Het
Adamts16 T A 13: 70,984,322 (GRCm39) S114C probably damaging Het
Agpat5 T C 8: 18,896,724 (GRCm39) V50A probably benign Het
Agrn T C 4: 156,263,891 (GRCm39) N124S probably benign Het
Ak8 T C 2: 28,625,638 (GRCm39) I227T probably benign Het
Akap6 A G 12: 53,188,808 (GRCm39) E2074G probably damaging Het
Apc T A 18: 34,445,265 (GRCm39) S702R probably damaging Het
Ascc3 T C 10: 50,596,769 (GRCm39) I1233T probably damaging Het
Asphd2 A T 5: 112,533,698 (GRCm39) F318I probably damaging Het
Bltp1 G A 3: 36,962,377 (GRCm39) A493T probably damaging Het
Bnc2 T C 4: 84,211,380 (GRCm39) T397A probably benign Het
Bpifb4 C T 2: 153,799,054 (GRCm39) T528I probably damaging Het
Brinp3 A G 1: 146,777,323 (GRCm39) E590G probably damaging Het
Ccdc149 A G 5: 52,542,477 (GRCm39) S372P probably benign Het
Cdhr2 A G 13: 54,874,589 (GRCm39) H887R probably benign Het
Clcn6 C T 4: 148,101,957 (GRCm39) V376I probably benign Het
Cspg4 A G 9: 56,799,928 (GRCm39) D1564G probably benign Het
Cux1 A T 5: 136,338,646 (GRCm39) S582T probably damaging Het
Cwh43 G A 5: 73,569,248 (GRCm39) A97T possibly damaging Het
Dsc1 A T 18: 20,219,826 (GRCm39) F781L probably damaging Het
Dsc3 G T 18: 20,099,348 (GRCm39) H723N probably benign Het
Ear10 A T 14: 44,160,512 (GRCm39) V105D probably damaging Het
Ecel1 A G 1: 87,077,231 (GRCm39) V659A possibly damaging Het
Eogt A T 6: 97,097,155 (GRCm39) F316I probably damaging Het
Etaa1 T C 11: 17,897,188 (GRCm39) N310D possibly damaging Het
Exoc3l2 G A 7: 19,203,633 (GRCm39) R75Q possibly damaging Het
Fam186a A C 15: 99,839,623 (GRCm39) L2207R probably damaging Het
Fam187b T C 7: 30,677,024 (GRCm39) Y178H probably damaging Het
Fat1 A T 8: 45,486,532 (GRCm39) Q3362L probably damaging Het
Fat3 A T 9: 15,849,694 (GRCm39) S3903T probably damaging Het
Fsip2 G A 2: 82,823,028 (GRCm39) V6254I possibly damaging Het
Gabra5 T C 7: 57,063,528 (GRCm39) T299A probably damaging Het
Gbp11 T C 5: 105,475,464 (GRCm39) T295A probably benign Het
Glcci1 C T 6: 8,573,203 (GRCm39) Q44* probably null Het
Gpc5 A T 14: 115,636,612 (GRCm39) T432S probably benign Het
Grhl1 G A 12: 24,634,857 (GRCm39) E228K probably damaging Het
Hyal5 T C 6: 24,891,708 (GRCm39) probably null Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Ints9 A G 14: 65,230,456 (GRCm39) I128V probably damaging Het
Kcnt2 A T 1: 140,302,850 (GRCm39) N130I probably damaging Het
Krba1 T C 6: 48,391,062 (GRCm39) V717A probably benign Het
Lrp12 T A 15: 39,741,584 (GRCm39) D377V probably damaging Het
Magi1 G T 6: 93,920,210 (GRCm39) D135E possibly damaging Het
Map10 T A 8: 126,397,984 (GRCm39) L459Q probably damaging Het
Mitf A G 6: 97,980,873 (GRCm39) D238G possibly damaging Het
Ms4a19 C T 19: 11,119,765 (GRCm39) G14D probably damaging Het
Mylk G T 16: 34,742,341 (GRCm39) R951L probably benign Het
Nacad T A 11: 6,549,235 (GRCm39) D1272V probably damaging Het
Nacad T A 11: 6,550,165 (GRCm39) K1009* probably null Het
Ncor1 T C 11: 62,264,124 (GRCm39) D786G probably benign Het
Oas2 G A 5: 120,886,603 (GRCm39) R188C probably benign Het
Odf2l A G 3: 144,841,479 (GRCm39) I300V probably benign Het
Or1j10 T A 2: 36,267,208 (GRCm39) V140D possibly damaging Het
Or51b17 A T 7: 103,542,342 (GRCm39) L200* probably null Het
Or51v8 A G 7: 103,320,163 (GRCm39) I25T possibly damaging Het
Or5p60 A G 7: 107,723,637 (GRCm39) S278P probably damaging Het
Or9i1 A G 19: 13,839,186 (GRCm39) T10A probably benign Het
Pes1 T A 11: 3,928,865 (GRCm39) D574E probably benign Het
Phf20 C T 2: 156,136,130 (GRCm39) R650C possibly damaging Het
Pias4 G A 10: 80,993,098 (GRCm39) T248I probably damaging Het
Pkhd1 T C 1: 20,282,175 (GRCm39) T2889A probably benign Het
Plcxd1 C A 5: 110,250,033 (GRCm39) probably null Het
Plekha7 A G 7: 115,776,133 (GRCm39) F194L probably damaging Het
Plxnb2 T C 15: 89,041,973 (GRCm39) N1642S possibly damaging Het
Pnpla7 A T 2: 24,901,576 (GRCm39) D534V probably damaging Het
Ppp2r5c A T 12: 110,521,313 (GRCm39) S279C probably damaging Het
Ptprq T A 10: 107,544,529 (GRCm39) T334S probably damaging Het
Rab39 T C 9: 53,597,821 (GRCm39) D148G probably benign Het
Reep3 A T 10: 66,870,432 (GRCm39) F121L probably benign Het
Reln G T 5: 22,106,661 (GRCm39) C3236* probably null Het
Rrp8 C T 7: 105,384,016 (GRCm39) C162Y probably damaging Het
Scrib C A 15: 75,936,835 (GRCm39) Q399H possibly damaging Het
Sertad1 T A 7: 27,189,224 (GRCm39) Y182N possibly damaging Het
Sfrp5 A G 19: 42,190,263 (GRCm39) V63A possibly damaging Het
Shoc1 T C 4: 59,069,317 (GRCm39) D703G probably benign Het
Slc46a1 T C 11: 78,357,985 (GRCm39) M346T probably benign Het
Sycp2 A G 2: 178,005,209 (GRCm39) L886S probably damaging Het
Teddm1b A T 1: 153,750,505 (GRCm39) I105F probably benign Het
Thumpd1 A T 7: 119,319,828 (GRCm39) I46N possibly damaging Het
Tmod4 A G 3: 95,035,164 (GRCm39) N223S probably damaging Het
Tnfrsf10b G C 14: 70,010,850 (GRCm39) C85S probably damaging Het
Tox T C 4: 6,697,439 (GRCm39) T455A probably benign Het
Tox T C 4: 6,741,536 (GRCm39) Q148R probably benign Het
Trp53bp1 A C 2: 121,100,426 (GRCm39) S109R probably damaging Het
Tshz2 A T 2: 169,726,888 (GRCm39) T26S probably benign Het
Tubb4a T A 17: 57,388,016 (GRCm39) N337Y probably damaging Het
Tubb6 T A 18: 67,534,458 (GRCm39) V119E probably damaging Het
Unk C T 11: 115,945,772 (GRCm39) T481I probably benign Het
Vmn2r112 C T 17: 22,820,259 (GRCm39) T44I probably benign Het
Vstm5 G A 9: 15,168,829 (GRCm39) G131D probably damaging Het
Wscd1 T C 11: 71,650,709 (GRCm39) L12P probably damaging Het
Zfp369 T A 13: 65,444,044 (GRCm39) S396T possibly damaging Het
Zfp932 T A 5: 110,157,209 (GRCm39) C302* probably null Het
Zfp972 A T 2: 177,548,728 (GRCm39) probably null Het
Zfyve21 C A 12: 111,794,028 (GRCm39) A212E probably benign Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGATTTGCTAGTGCGTTCAC -3'
(R):5'- AAAGGCGTGGAGTTGGTTATAC -3'

Sequencing Primer
(F):5'- GCTAGTGCGTTCACATTTTTATG -3'
(R):5'- TGGAGTTGGTTATACTGTGTGTATC -3'
Posted On 2018-04-27