Incidental Mutation 'R6351:Fam187b'
ID514247
Institutional Source Beutler Lab
Gene Symbol Fam187b
Ensembl Gene ENSMUSG00000046826
Gene Namefamily with sequence similarity 187, member B
Synonyms1700020B09Rik, Tmem162
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6351 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30973790-30989726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30977599 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 178 (Y178H)
Ref Sequence ENSEMBL: ENSMUSP00000057020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001279] [ENSMUST00000058093] [ENSMUST00000098553] [ENSMUST00000108116] [ENSMUST00000128384] [ENSMUST00000129773] [ENSMUST00000147431] [ENSMUST00000205961]
Predicted Effect probably benign
Transcript: ENSMUST00000001279
SMART Domains Protein: ENSMUSP00000001279
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 206 253 9.6e-27 PFAM
low complexity region 280 296 N/A INTRINSIC
low complexity region 445 464 N/A INTRINSIC
low complexity region 468 487 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058093
AA Change: Y178H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057020
Gene: ENSMUSG00000046826
AA Change: Y178H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:IG 27 116 4e-30 BLAST
Blast:IG_like 223 290 4e-6 BLAST
transmembrane domain 324 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098553
SMART Domains Protein: ENSMUSP00000096153
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
low complexity region 212 228 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 400 419 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108116
SMART Domains Protein: ENSMUSP00000103751
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 187 235 2.3e-25 PFAM
low complexity region 261 277 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 477 494 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128384
SMART Domains Protein: ENSMUSP00000144424
Gene: ENSMUSG00000046826

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Blast:IG 45 133 2e-17 BLAST
SCOP:d1wiu__ 53 125 1e-3 SMART
IG_like 238 306 1.9e-2 SMART
transmembrane domain 340 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129773
SMART Domains Protein: ENSMUSP00000144533
Gene: ENSMUSG00000046826

DomainStartEndE-ValueType
transmembrane domain 61 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147431
SMART Domains Protein: ENSMUSP00000123487
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 253 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206754
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik C T 19: 11,142,401 G14D probably damaging Het
4932438A13Rik G A 3: 36,908,228 A493T probably damaging Het
Acaa1a C A 9: 119,341,564 S17* probably null Het
Adamts16 T A 13: 70,836,203 S114C probably damaging Het
Agpat5 T C 8: 18,846,708 V50A probably benign Het
Agrn T C 4: 156,179,434 N124S probably benign Het
AI481877 T C 4: 59,069,317 D703G probably benign Het
Ak8 T C 2: 28,735,626 I227T probably benign Het
Akap6 A G 12: 53,142,025 E2074G probably damaging Het
Apc T A 18: 34,312,212 S702R probably damaging Het
Ascc3 T C 10: 50,720,673 I1233T probably damaging Het
Asphd2 A T 5: 112,385,832 F318I probably damaging Het
Bnc2 T C 4: 84,293,143 T397A probably benign Het
Bpifb4 C T 2: 153,957,134 T528I probably damaging Het
Brinp3 A G 1: 146,901,585 E590G probably damaging Het
Ccdc149 A G 5: 52,385,135 S372P probably benign Het
Cdhr2 A G 13: 54,726,776 H887R probably benign Het
Clcn6 C T 4: 148,017,500 V376I probably benign Het
Cntln T G 4: 85,115,354 C1305W probably damaging Het
Cspg4 A G 9: 56,892,644 D1564G probably benign Het
Cux1 A T 5: 136,309,792 S582T probably damaging Het
Cwh43 G A 5: 73,411,905 A97T possibly damaging Het
Dsc1 A T 18: 20,086,769 F781L probably damaging Het
Dsc3 G T 18: 19,966,291 H723N probably benign Het
Ear10 A T 14: 43,923,055 V105D probably damaging Het
Ecel1 A G 1: 87,149,509 V659A possibly damaging Het
Eogt A T 6: 97,120,194 F316I probably damaging Het
Etaa1 T C 11: 17,947,188 N310D possibly damaging Het
Exoc3l2 G A 7: 19,469,708 R75Q possibly damaging Het
Fam186a A C 15: 99,941,742 L2207R probably damaging Het
Fat1 A T 8: 45,033,495 Q3362L probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fsip2 G A 2: 82,992,684 V6254I possibly damaging Het
Gabra5 T C 7: 57,413,780 T299A probably damaging Het
Gbp11 T C 5: 105,327,598 T295A probably benign Het
Glcci1 C T 6: 8,573,203 Q44* probably null Het
Gpc5 A T 14: 115,399,200 T432S probably benign Het
Grhl1 G A 12: 24,584,858 E228K probably damaging Het
Hyal5 T C 6: 24,891,709 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints9 A G 14: 64,993,007 I128V probably damaging Het
Kcnt2 A T 1: 140,375,112 N130I probably damaging Het
Krba1 T C 6: 48,414,128 V717A probably benign Het
Lrp12 T A 15: 39,878,188 D377V probably damaging Het
Magi1 G T 6: 93,943,229 D135E possibly damaging Het
Map10 T A 8: 125,671,245 L459Q probably damaging Het
Mitf A G 6: 98,003,912 D238G possibly damaging Het
Mylk G T 16: 34,921,971 R951L probably benign Het
Nacad T A 11: 6,599,235 D1272V probably damaging Het
Nacad T A 11: 6,600,165 K1009* probably null Het
Ncor1 T C 11: 62,373,298 D786G probably benign Het
Oas2 G A 5: 120,748,538 R188C probably benign Het
Odf2l A G 3: 145,135,718 I300V probably benign Het
Olfr1502 A G 19: 13,861,822 T10A probably benign Het
Olfr338 T A 2: 36,377,196 V140D possibly damaging Het
Olfr484 A G 7: 108,124,430 S278P probably damaging Het
Olfr624 A G 7: 103,670,956 I25T possibly damaging Het
Olfr64 A T 7: 103,893,135 L200* probably null Het
Pes1 T A 11: 3,978,865 D574E probably benign Het
Phf20 C T 2: 156,294,210 R650C possibly damaging Het
Pias4 G A 10: 81,157,264 T248I probably damaging Het
Pkhd1 T C 1: 20,211,951 T2889A probably benign Het
Plcxd1 C A 5: 110,102,167 probably null Het
Plekha7 A G 7: 116,176,898 F194L probably damaging Het
Plxnb2 T C 15: 89,157,770 N1642S possibly damaging Het
Pnpla7 A T 2: 25,011,564 D534V probably damaging Het
Ppp2r5c A T 12: 110,554,879 S279C probably damaging Het
Ptprq T A 10: 107,708,668 T334S probably damaging Het
Rab39 T C 9: 53,686,521 D148G probably benign Het
Reep3 A T 10: 67,034,653 F121L probably benign Het
Reln G T 5: 21,901,663 C3236* probably null Het
Rrp8 C T 7: 105,734,809 C162Y probably damaging Het
Scrib C A 15: 76,064,986 Q399H possibly damaging Het
Sertad1 T A 7: 27,489,799 Y182N possibly damaging Het
Sfrp5 A G 19: 42,201,824 V63A possibly damaging Het
Slc46a1 T C 11: 78,467,159 M346T probably benign Het
Sycp2 A G 2: 178,363,416 L886S probably damaging Het
Teddm1b A T 1: 153,874,759 I105F probably benign Het
Thumpd1 A T 7: 119,720,605 I46N possibly damaging Het
Tmod4 A G 3: 95,127,853 N223S probably damaging Het
Tnfrsf10b G C 14: 69,773,401 C85S probably damaging Het
Tox T C 4: 6,697,439 T455A probably benign Het
Tox T C 4: 6,741,536 Q148R probably benign Het
Trp53bp1 A C 2: 121,269,945 S109R probably damaging Het
Tshz2 A T 2: 169,884,968 T26S probably benign Het
Tubb4a T A 17: 57,081,016 N337Y probably damaging Het
Tubb6 T A 18: 67,401,388 V119E probably damaging Het
Unk C T 11: 116,054,946 T481I probably benign Het
Vmn2r112 C T 17: 22,601,278 T44I probably benign Het
Vstm5 G A 9: 15,257,533 G131D probably damaging Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp369 T A 13: 65,296,230 S396T possibly damaging Het
Zfp932 T A 5: 110,009,343 C302* probably null Het
Zfp972 A T 2: 177,906,935 probably null Het
Zfyve21 C A 12: 111,827,594 A212E probably benign Het
Other mutations in Fam187b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0131:Fam187b UTSW 7 30989120 missense probably damaging 1.00
R0131:Fam187b UTSW 7 30989120 missense probably damaging 1.00
R0132:Fam187b UTSW 7 30989120 missense probably damaging 1.00
R0594:Fam187b UTSW 7 30977154 nonsense probably null
R1728:Fam187b UTSW 7 30989020 nonsense probably null
R2965:Fam187b UTSW 7 30977729 missense probably benign 0.44
R3104:Fam187b UTSW 7 30977240 missense probably benign 0.00
R3106:Fam187b UTSW 7 30977240 missense probably benign 0.00
R4607:Fam187b UTSW 7 30977745 missense probably benign 0.28
R4608:Fam187b UTSW 7 30977745 missense probably benign 0.28
R4612:Fam187b UTSW 7 30977093 missense possibly damaging 0.69
R4672:Fam187b UTSW 7 30977543 missense probably damaging 1.00
R4801:Fam187b UTSW 7 30977090 missense possibly damaging 0.84
R4802:Fam187b UTSW 7 30977090 missense possibly damaging 0.84
R4959:Fam187b UTSW 7 30982262 missense probably damaging 1.00
R5820:Fam187b UTSW 7 30977152 missense probably damaging 1.00
R6624:Fam187b UTSW 7 30977187 missense probably benign 0.26
R6823:Fam187b UTSW 7 30989290 missense probably benign 0.01
R7725:Fam187b UTSW 7 30977714 missense possibly damaging 0.91
X0063:Fam187b UTSW 7 30989320 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGCCCGTTTGGTAGAATATG -3'
(R):5'- AAGGGACACTTGAGTCGAGC -3'

Sequencing Primer
(F):5'- TCAGAACATAGCTCTGTTGCAC -3'
(R):5'- ACACTTGAGTCGAGCATTGC -3'
Posted On2018-04-27