Incidental Mutation 'R6351:Olfr64'
ID514250
Institutional Source Beutler Lab
Gene Symbol Olfr64
Ensembl Gene ENSMUSG00000063615
Gene Nameolfactory receptor 64
SynonymsGA_x6K02T2PBJ9-6648196-6649143, 5'[b]2, MOR1-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R6351 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103889485-103894485 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 103893135 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 200 (L200*)
Ref Sequence ENSEMBL: ENSMUSP00000080444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081748]
Predicted Effect probably null
Transcript: ENSMUST00000081748
AA Change: L200*
SMART Domains Protein: ENSMUSP00000080444
Gene: ENSMUSG00000063615
AA Change: L200*

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.4e-113 PFAM
Pfam:7TM_GPCR_Srsx 33 295 4.2e-6 PFAM
Pfam:7tm_1 39 290 1.1e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik C T 19: 11,142,401 G14D probably damaging Het
4932438A13Rik G A 3: 36,908,228 A493T probably damaging Het
Acaa1a C A 9: 119,341,564 S17* probably null Het
Adamts16 T A 13: 70,836,203 S114C probably damaging Het
Agpat5 T C 8: 18,846,708 V50A probably benign Het
Agrn T C 4: 156,179,434 N124S probably benign Het
AI481877 T C 4: 59,069,317 D703G probably benign Het
Ak8 T C 2: 28,735,626 I227T probably benign Het
Akap6 A G 12: 53,142,025 E2074G probably damaging Het
Apc T A 18: 34,312,212 S702R probably damaging Het
Ascc3 T C 10: 50,720,673 I1233T probably damaging Het
Asphd2 A T 5: 112,385,832 F318I probably damaging Het
Bnc2 T C 4: 84,293,143 T397A probably benign Het
Bpifb4 C T 2: 153,957,134 T528I probably damaging Het
Brinp3 A G 1: 146,901,585 E590G probably damaging Het
Ccdc149 A G 5: 52,385,135 S372P probably benign Het
Cdhr2 A G 13: 54,726,776 H887R probably benign Het
Clcn6 C T 4: 148,017,500 V376I probably benign Het
Cntln T G 4: 85,115,354 C1305W probably damaging Het
Cspg4 A G 9: 56,892,644 D1564G probably benign Het
Cux1 A T 5: 136,309,792 S582T probably damaging Het
Cwh43 G A 5: 73,411,905 A97T possibly damaging Het
Dsc1 A T 18: 20,086,769 F781L probably damaging Het
Dsc3 G T 18: 19,966,291 H723N probably benign Het
Ear10 A T 14: 43,923,055 V105D probably damaging Het
Ecel1 A G 1: 87,149,509 V659A possibly damaging Het
Eogt A T 6: 97,120,194 F316I probably damaging Het
Etaa1 T C 11: 17,947,188 N310D possibly damaging Het
Exoc3l2 G A 7: 19,469,708 R75Q possibly damaging Het
Fam186a A C 15: 99,941,742 L2207R probably damaging Het
Fam187b T C 7: 30,977,599 Y178H probably damaging Het
Fat1 A T 8: 45,033,495 Q3362L probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fsip2 G A 2: 82,992,684 V6254I possibly damaging Het
Gabra5 T C 7: 57,413,780 T299A probably damaging Het
Gbp11 T C 5: 105,327,598 T295A probably benign Het
Glcci1 C T 6: 8,573,203 Q44* probably null Het
Gpc5 A T 14: 115,399,200 T432S probably benign Het
Grhl1 G A 12: 24,584,858 E228K probably damaging Het
Hyal5 T C 6: 24,891,709 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints9 A G 14: 64,993,007 I128V probably damaging Het
Kcnt2 A T 1: 140,375,112 N130I probably damaging Het
Krba1 T C 6: 48,414,128 V717A probably benign Het
Lrp12 T A 15: 39,878,188 D377V probably damaging Het
Magi1 G T 6: 93,943,229 D135E possibly damaging Het
Map10 T A 8: 125,671,245 L459Q probably damaging Het
Mitf A G 6: 98,003,912 D238G possibly damaging Het
Mylk G T 16: 34,921,971 R951L probably benign Het
Nacad T A 11: 6,599,235 D1272V probably damaging Het
Nacad T A 11: 6,600,165 K1009* probably null Het
Ncor1 T C 11: 62,373,298 D786G probably benign Het
Oas2 G A 5: 120,748,538 R188C probably benign Het
Odf2l A G 3: 145,135,718 I300V probably benign Het
Olfr1502 A G 19: 13,861,822 T10A probably benign Het
Olfr338 T A 2: 36,377,196 V140D possibly damaging Het
Olfr484 A G 7: 108,124,430 S278P probably damaging Het
Olfr624 A G 7: 103,670,956 I25T possibly damaging Het
Pes1 T A 11: 3,978,865 D574E probably benign Het
Phf20 C T 2: 156,294,210 R650C possibly damaging Het
Pias4 G A 10: 81,157,264 T248I probably damaging Het
Pkhd1 T C 1: 20,211,951 T2889A probably benign Het
Plcxd1 C A 5: 110,102,167 probably null Het
Plekha7 A G 7: 116,176,898 F194L probably damaging Het
Plxnb2 T C 15: 89,157,770 N1642S possibly damaging Het
Pnpla7 A T 2: 25,011,564 D534V probably damaging Het
Ppp2r5c A T 12: 110,554,879 S279C probably damaging Het
Ptprq T A 10: 107,708,668 T334S probably damaging Het
Rab39 T C 9: 53,686,521 D148G probably benign Het
Reep3 A T 10: 67,034,653 F121L probably benign Het
Reln G T 5: 21,901,663 C3236* probably null Het
Rrp8 C T 7: 105,734,809 C162Y probably damaging Het
Scrib C A 15: 76,064,986 Q399H possibly damaging Het
Sertad1 T A 7: 27,489,799 Y182N possibly damaging Het
Sfrp5 A G 19: 42,201,824 V63A possibly damaging Het
Slc46a1 T C 11: 78,467,159 M346T probably benign Het
Sycp2 A G 2: 178,363,416 L886S probably damaging Het
Teddm1b A T 1: 153,874,759 I105F probably benign Het
Thumpd1 A T 7: 119,720,605 I46N possibly damaging Het
Tmod4 A G 3: 95,127,853 N223S probably damaging Het
Tnfrsf10b G C 14: 69,773,401 C85S probably damaging Het
Tox T C 4: 6,697,439 T455A probably benign Het
Tox T C 4: 6,741,536 Q148R probably benign Het
Trp53bp1 A C 2: 121,269,945 S109R probably damaging Het
Tshz2 A T 2: 169,884,968 T26S probably benign Het
Tubb4a T A 17: 57,081,016 N337Y probably damaging Het
Tubb6 T A 18: 67,401,388 V119E probably damaging Het
Unk C T 11: 116,054,946 T481I probably benign Het
Vmn2r112 C T 17: 22,601,278 T44I probably benign Het
Vstm5 G A 9: 15,257,533 G131D probably damaging Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp369 T A 13: 65,296,230 S396T possibly damaging Het
Zfp932 T A 5: 110,009,343 C302* probably null Het
Zfp972 A T 2: 177,906,935 probably null Het
Zfyve21 C A 12: 111,827,594 A212E probably benign Het
Other mutations in Olfr64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Olfr64 APN 7 103892864 nonsense probably null
IGL01597:Olfr64 APN 7 103893096 missense probably benign 0.01
IGL01868:Olfr64 APN 7 103893376 nonsense probably null
IGL02502:Olfr64 APN 7 103893489 missense probably damaging 0.99
R0294:Olfr64 UTSW 7 103892930 missense probably benign 0.09
R0534:Olfr64 UTSW 7 103893231 missense probably benign 0.00
R0838:Olfr64 UTSW 7 103893415 missense probably benign 0.00
R1350:Olfr64 UTSW 7 103893730 missense probably benign 0.01
R1733:Olfr64 UTSW 7 103892911 missense probably benign 0.40
R1768:Olfr64 UTSW 7 103893277 missense probably benign 0.28
R1780:Olfr64 UTSW 7 103893555 missense probably damaging 1.00
R1836:Olfr64 UTSW 7 103893385 missense probably damaging 0.98
R1956:Olfr64 UTSW 7 103893718 missense probably benign 0.01
R2075:Olfr64 UTSW 7 103892920 missense probably damaging 0.96
R4677:Olfr64 UTSW 7 103893408 missense probably damaging 1.00
R4884:Olfr64 UTSW 7 103893655 missense probably benign 0.04
R4899:Olfr64 UTSW 7 103893465 missense possibly damaging 0.54
R5753:Olfr64 UTSW 7 103893201 missense probably damaging 1.00
R6997:Olfr64 UTSW 7 103893031 missense probably benign 0.00
X0017:Olfr64 UTSW 7 103893151 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGTGCATGCTTTCCAAACC -3'
(R):5'- TCCTTACCAATTCCAGGGTTATAGC -3'

Sequencing Primer
(F):5'- CCTGTGAATGAATGTCAGGCCAATC -3'
(R):5'- CCAATTCCAGGGTTATAGCTATAGG -3'
Posted On2018-04-27