Incidental Mutation 'R6351:Rrp8'
ID514251
Institutional Source Beutler Lab
Gene Symbol Rrp8
Ensembl Gene ENSMUSG00000030888
Gene Nameribosomal RNA processing 8, methyltransferase, homolog (yeast)
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R6351 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105731730-105737385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105734809 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 162 (C162Y)
Ref Sequence ENSEMBL: ENSMUSP00000095752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033179] [ENSMUST00000033182] [ENSMUST00000098148] [ENSMUST00000136687] [ENSMUST00000141116] [ENSMUST00000149695] [ENSMUST00000163389]
Predicted Effect probably damaging
Transcript: ENSMUST00000033179
AA Change: C116Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033179
Gene: ENSMUSG00000030888
AA Change: C116Y

DomainStartEndE-ValueType
low complexity region 186 202 N/A INTRINSIC
Pfam:Methyltransf_8 238 457 2.4e-107 PFAM
Pfam:Methyltransf_11 314 391 2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033182
SMART Domains Protein: ENSMUSP00000033182
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase 193 445 1.5e-25 PFAM
Pfam:Pkinase_Tyr 193 446 7.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098148
AA Change: C162Y

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095752
Gene: ENSMUSG00000030888
AA Change: C162Y

DomainStartEndE-ValueType
low complexity region 232 248 N/A INTRINSIC
Pfam:Methyltransf_8 284 503 7.5e-107 PFAM
Pfam:Methyltransf_11 348 437 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127738
Predicted Effect probably benign
Transcript: ENSMUST00000136687
SMART Domains Protein: ENSMUSP00000123443
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137902
Predicted Effect probably benign
Transcript: ENSMUST00000141116
SMART Domains Protein: ENSMUSP00000118105
Gene: ENSMUSG00000043866

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 45 91 N/A INTRINSIC
Pfam:TFIID_30kDa 128 177 6.1e-30 PFAM
low complexity region 181 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148176
Predicted Effect probably benign
Transcript: ENSMUST00000149695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154852
Predicted Effect probably benign
Transcript: ENSMUST00000163389
SMART Domains Protein: ENSMUSP00000130341
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase_Tyr 193 446 4e-39 PFAM
Pfam:Pkinase 195 445 3e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik C T 19: 11,142,401 G14D probably damaging Het
4932438A13Rik G A 3: 36,908,228 A493T probably damaging Het
Acaa1a C A 9: 119,341,564 S17* probably null Het
Adamts16 T A 13: 70,836,203 S114C probably damaging Het
Agpat5 T C 8: 18,846,708 V50A probably benign Het
Agrn T C 4: 156,179,434 N124S probably benign Het
AI481877 T C 4: 59,069,317 D703G probably benign Het
Ak8 T C 2: 28,735,626 I227T probably benign Het
Akap6 A G 12: 53,142,025 E2074G probably damaging Het
Apc T A 18: 34,312,212 S702R probably damaging Het
Ascc3 T C 10: 50,720,673 I1233T probably damaging Het
Asphd2 A T 5: 112,385,832 F318I probably damaging Het
Bnc2 T C 4: 84,293,143 T397A probably benign Het
Bpifb4 C T 2: 153,957,134 T528I probably damaging Het
Brinp3 A G 1: 146,901,585 E590G probably damaging Het
Ccdc149 A G 5: 52,385,135 S372P probably benign Het
Cdhr2 A G 13: 54,726,776 H887R probably benign Het
Clcn6 C T 4: 148,017,500 V376I probably benign Het
Cntln T G 4: 85,115,354 C1305W probably damaging Het
Cspg4 A G 9: 56,892,644 D1564G probably benign Het
Cux1 A T 5: 136,309,792 S582T probably damaging Het
Cwh43 G A 5: 73,411,905 A97T possibly damaging Het
Dsc1 A T 18: 20,086,769 F781L probably damaging Het
Dsc3 G T 18: 19,966,291 H723N probably benign Het
Ear10 A T 14: 43,923,055 V105D probably damaging Het
Ecel1 A G 1: 87,149,509 V659A possibly damaging Het
Eogt A T 6: 97,120,194 F316I probably damaging Het
Etaa1 T C 11: 17,947,188 N310D possibly damaging Het
Exoc3l2 G A 7: 19,469,708 R75Q possibly damaging Het
Fam186a A C 15: 99,941,742 L2207R probably damaging Het
Fam187b T C 7: 30,977,599 Y178H probably damaging Het
Fat1 A T 8: 45,033,495 Q3362L probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fsip2 G A 2: 82,992,684 V6254I possibly damaging Het
Gabra5 T C 7: 57,413,780 T299A probably damaging Het
Gbp11 T C 5: 105,327,598 T295A probably benign Het
Glcci1 C T 6: 8,573,203 Q44* probably null Het
Gpc5 A T 14: 115,399,200 T432S probably benign Het
Grhl1 G A 12: 24,584,858 E228K probably damaging Het
Hyal5 T C 6: 24,891,709 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints9 A G 14: 64,993,007 I128V probably damaging Het
Kcnt2 A T 1: 140,375,112 N130I probably damaging Het
Krba1 T C 6: 48,414,128 V717A probably benign Het
Lrp12 T A 15: 39,878,188 D377V probably damaging Het
Magi1 G T 6: 93,943,229 D135E possibly damaging Het
Map10 T A 8: 125,671,245 L459Q probably damaging Het
Mitf A G 6: 98,003,912 D238G possibly damaging Het
Mylk G T 16: 34,921,971 R951L probably benign Het
Nacad T A 11: 6,599,235 D1272V probably damaging Het
Nacad T A 11: 6,600,165 K1009* probably null Het
Ncor1 T C 11: 62,373,298 D786G probably benign Het
Oas2 G A 5: 120,748,538 R188C probably benign Het
Odf2l A G 3: 145,135,718 I300V probably benign Het
Olfr1502 A G 19: 13,861,822 T10A probably benign Het
Olfr338 T A 2: 36,377,196 V140D possibly damaging Het
Olfr484 A G 7: 108,124,430 S278P probably damaging Het
Olfr624 A G 7: 103,670,956 I25T possibly damaging Het
Olfr64 A T 7: 103,893,135 L200* probably null Het
Pes1 T A 11: 3,978,865 D574E probably benign Het
Phf20 C T 2: 156,294,210 R650C possibly damaging Het
Pias4 G A 10: 81,157,264 T248I probably damaging Het
Pkhd1 T C 1: 20,211,951 T2889A probably benign Het
Plcxd1 C A 5: 110,102,167 probably null Het
Plekha7 A G 7: 116,176,898 F194L probably damaging Het
Plxnb2 T C 15: 89,157,770 N1642S possibly damaging Het
Pnpla7 A T 2: 25,011,564 D534V probably damaging Het
Ppp2r5c A T 12: 110,554,879 S279C probably damaging Het
Ptprq T A 10: 107,708,668 T334S probably damaging Het
Rab39 T C 9: 53,686,521 D148G probably benign Het
Reep3 A T 10: 67,034,653 F121L probably benign Het
Reln G T 5: 21,901,663 C3236* probably null Het
Scrib C A 15: 76,064,986 Q399H possibly damaging Het
Sertad1 T A 7: 27,489,799 Y182N possibly damaging Het
Sfrp5 A G 19: 42,201,824 V63A possibly damaging Het
Slc46a1 T C 11: 78,467,159 M346T probably benign Het
Sycp2 A G 2: 178,363,416 L886S probably damaging Het
Teddm1b A T 1: 153,874,759 I105F probably benign Het
Thumpd1 A T 7: 119,720,605 I46N possibly damaging Het
Tmod4 A G 3: 95,127,853 N223S probably damaging Het
Tnfrsf10b G C 14: 69,773,401 C85S probably damaging Het
Tox T C 4: 6,697,439 T455A probably benign Het
Tox T C 4: 6,741,536 Q148R probably benign Het
Trp53bp1 A C 2: 121,269,945 S109R probably damaging Het
Tshz2 A T 2: 169,884,968 T26S probably benign Het
Tubb4a T A 17: 57,081,016 N337Y probably damaging Het
Tubb6 T A 18: 67,401,388 V119E probably damaging Het
Unk C T 11: 116,054,946 T481I probably benign Het
Vmn2r112 C T 17: 22,601,278 T44I probably benign Het
Vstm5 G A 9: 15,257,533 G131D probably damaging Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp369 T A 13: 65,296,230 S396T possibly damaging Het
Zfp932 T A 5: 110,009,343 C302* probably null Het
Zfp972 A T 2: 177,906,935 probably null Het
Zfyve21 C A 12: 111,827,594 A212E probably benign Het
Other mutations in Rrp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rrp8 APN 7 105733016 unclassified probably benign
IGL02792:Rrp8 APN 7 105733811 nonsense probably null
IGL03010:Rrp8 APN 7 105734391 missense probably benign 0.01
IGL03404:Rrp8 APN 7 105734938 missense probably benign 0.41
IGL03046:Rrp8 UTSW 7 105734902 missense probably benign 0.00
R0682:Rrp8 UTSW 7 105734011 missense probably damaging 0.97
R2314:Rrp8 UTSW 7 105734804 missense probably benign 0.37
R4222:Rrp8 UTSW 7 105734022 missense possibly damaging 0.86
R4778:Rrp8 UTSW 7 105737274 intron probably benign
R4940:Rrp8 UTSW 7 105734077 nonsense probably null
R5315:Rrp8 UTSW 7 105734000 missense probably benign 0.00
R5480:Rrp8 UTSW 7 105734129 missense probably damaging 1.00
R5630:Rrp8 UTSW 7 105733401 missense possibly damaging 0.83
R6266:Rrp8 UTSW 7 105736389 missense probably damaging 1.00
R6353:Rrp8 UTSW 7 105734118 nonsense probably null
R7070:Rrp8 UTSW 7 105734876 missense possibly damaging 0.90
R7092:Rrp8 UTSW 7 105734109 missense probably damaging 1.00
R7632:Rrp8 UTSW 7 105736520 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGTCAGTTCACAGCCTC -3'
(R):5'- ATCTCTTGGCCACATTACGG -3'

Sequencing Primer
(F):5'- GTCAGTTCACAGCCTCCCCAC -3'
(R):5'- CACATTACGGGCTCTGGAAG -3'
Posted On2018-04-27