Incidental Mutation 'R6351:Pes1'
ID514267
Institutional Source Beutler Lab
Gene Symbol Pes1
Ensembl Gene ENSMUSG00000020430
Gene Namepescadillo ribosomal biogenesis factor 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6351 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location3963975-3980004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3978865 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 574 (D574E)
Ref Sequence ENSEMBL: ENSMUSP00000105612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020705] [ENSMUST00000042344] [ENSMUST00000063004] [ENSMUST00000078757] [ENSMUST00000109985]
Predicted Effect probably benign
Transcript: ENSMUST00000020705
AA Change: D570E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020705
Gene: ENSMUSG00000020430
AA Change: D570E

DomainStartEndE-ValueType
Pfam:Pescadillo_N 6 286 5.1e-135 PFAM
BRCT 323 404 4.81e-7 SMART
coiled coil region 469 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042344
SMART Domains Protein: ENSMUSP00000048953
Gene: ENSMUSG00000034493

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 84 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063004
SMART Domains Protein: ENSMUSP00000058348
Gene: ENSMUSG00000049721

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078757
SMART Domains Protein: ENSMUSP00000077815
Gene: ENSMUSG00000049721

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109985
AA Change: D574E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105612
Gene: ENSMUSG00000020430
AA Change: D574E

DomainStartEndE-ValueType
Pfam:Pescadillo_N 7 284 1.1e-130 PFAM
BRCT 327 408 4.81e-7 SMART
coiled coil region 473 546 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137544
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted disuption of the mouse gene results in embryonic arrest at morula stages of development, as well as failure of nucleologenesis and disruption of ribosome biogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik C T 19: 11,142,401 G14D probably damaging Het
4932438A13Rik G A 3: 36,908,228 A493T probably damaging Het
Acaa1a C A 9: 119,341,564 S17* probably null Het
Adamts16 T A 13: 70,836,203 S114C probably damaging Het
Agpat5 T C 8: 18,846,708 V50A probably benign Het
Agrn T C 4: 156,179,434 N124S probably benign Het
AI481877 T C 4: 59,069,317 D703G probably benign Het
Ak8 T C 2: 28,735,626 I227T probably benign Het
Akap6 A G 12: 53,142,025 E2074G probably damaging Het
Apc T A 18: 34,312,212 S702R probably damaging Het
Ascc3 T C 10: 50,720,673 I1233T probably damaging Het
Asphd2 A T 5: 112,385,832 F318I probably damaging Het
Bnc2 T C 4: 84,293,143 T397A probably benign Het
Bpifb4 C T 2: 153,957,134 T528I probably damaging Het
Brinp3 A G 1: 146,901,585 E590G probably damaging Het
Ccdc149 A G 5: 52,385,135 S372P probably benign Het
Cdhr2 A G 13: 54,726,776 H887R probably benign Het
Clcn6 C T 4: 148,017,500 V376I probably benign Het
Cntln T G 4: 85,115,354 C1305W probably damaging Het
Cspg4 A G 9: 56,892,644 D1564G probably benign Het
Cux1 A T 5: 136,309,792 S582T probably damaging Het
Cwh43 G A 5: 73,411,905 A97T possibly damaging Het
Dsc1 A T 18: 20,086,769 F781L probably damaging Het
Dsc3 G T 18: 19,966,291 H723N probably benign Het
Ear10 A T 14: 43,923,055 V105D probably damaging Het
Ecel1 A G 1: 87,149,509 V659A possibly damaging Het
Eogt A T 6: 97,120,194 F316I probably damaging Het
Etaa1 T C 11: 17,947,188 N310D possibly damaging Het
Exoc3l2 G A 7: 19,469,708 R75Q possibly damaging Het
Fam186a A C 15: 99,941,742 L2207R probably damaging Het
Fam187b T C 7: 30,977,599 Y178H probably damaging Het
Fat1 A T 8: 45,033,495 Q3362L probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fsip2 G A 2: 82,992,684 V6254I possibly damaging Het
Gabra5 T C 7: 57,413,780 T299A probably damaging Het
Gbp11 T C 5: 105,327,598 T295A probably benign Het
Glcci1 C T 6: 8,573,203 Q44* probably null Het
Gpc5 A T 14: 115,399,200 T432S probably benign Het
Grhl1 G A 12: 24,584,858 E228K probably damaging Het
Hyal5 T C 6: 24,891,709 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints9 A G 14: 64,993,007 I128V probably damaging Het
Kcnt2 A T 1: 140,375,112 N130I probably damaging Het
Krba1 T C 6: 48,414,128 V717A probably benign Het
Lrp12 T A 15: 39,878,188 D377V probably damaging Het
Magi1 G T 6: 93,943,229 D135E possibly damaging Het
Map10 T A 8: 125,671,245 L459Q probably damaging Het
Mitf A G 6: 98,003,912 D238G possibly damaging Het
Mylk G T 16: 34,921,971 R951L probably benign Het
Nacad T A 11: 6,599,235 D1272V probably damaging Het
Nacad T A 11: 6,600,165 K1009* probably null Het
Ncor1 T C 11: 62,373,298 D786G probably benign Het
Oas2 G A 5: 120,748,538 R188C probably benign Het
Odf2l A G 3: 145,135,718 I300V probably benign Het
Olfr1502 A G 19: 13,861,822 T10A probably benign Het
Olfr338 T A 2: 36,377,196 V140D possibly damaging Het
Olfr484 A G 7: 108,124,430 S278P probably damaging Het
Olfr624 A G 7: 103,670,956 I25T possibly damaging Het
Olfr64 A T 7: 103,893,135 L200* probably null Het
Phf20 C T 2: 156,294,210 R650C possibly damaging Het
Pias4 G A 10: 81,157,264 T248I probably damaging Het
Pkhd1 T C 1: 20,211,951 T2889A probably benign Het
Plcxd1 C A 5: 110,102,167 probably null Het
Plekha7 A G 7: 116,176,898 F194L probably damaging Het
Plxnb2 T C 15: 89,157,770 N1642S possibly damaging Het
Pnpla7 A T 2: 25,011,564 D534V probably damaging Het
Ppp2r5c A T 12: 110,554,879 S279C probably damaging Het
Ptprq T A 10: 107,708,668 T334S probably damaging Het
Rab39 T C 9: 53,686,521 D148G probably benign Het
Reep3 A T 10: 67,034,653 F121L probably benign Het
Reln G T 5: 21,901,663 C3236* probably null Het
Rrp8 C T 7: 105,734,809 C162Y probably damaging Het
Scrib C A 15: 76,064,986 Q399H possibly damaging Het
Sertad1 T A 7: 27,489,799 Y182N possibly damaging Het
Sfrp5 A G 19: 42,201,824 V63A possibly damaging Het
Slc46a1 T C 11: 78,467,159 M346T probably benign Het
Sycp2 A G 2: 178,363,416 L886S probably damaging Het
Teddm1b A T 1: 153,874,759 I105F probably benign Het
Thumpd1 A T 7: 119,720,605 I46N possibly damaging Het
Tmod4 A G 3: 95,127,853 N223S probably damaging Het
Tnfrsf10b G C 14: 69,773,401 C85S probably damaging Het
Tox T C 4: 6,697,439 T455A probably benign Het
Tox T C 4: 6,741,536 Q148R probably benign Het
Trp53bp1 A C 2: 121,269,945 S109R probably damaging Het
Tshz2 A T 2: 169,884,968 T26S probably benign Het
Tubb4a T A 17: 57,081,016 N337Y probably damaging Het
Tubb6 T A 18: 67,401,388 V119E probably damaging Het
Unk C T 11: 116,054,946 T481I probably benign Het
Vmn2r112 C T 17: 22,601,278 T44I probably benign Het
Vstm5 G A 9: 15,257,533 G131D probably damaging Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp369 T A 13: 65,296,230 S396T possibly damaging Het
Zfp932 T A 5: 110,009,343 C302* probably null Het
Zfp972 A T 2: 177,906,935 probably null Het
Zfyve21 C A 12: 111,827,594 A212E probably benign Het
Other mutations in Pes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Pes1 APN 11 3976803 missense probably damaging 1.00
IGL01448:Pes1 APN 11 3977979 missense possibly damaging 0.89
H8441:Pes1 UTSW 11 3977636 small deletion probably benign
R0634:Pes1 UTSW 11 3977794 splice site probably benign
R0634:Pes1 UTSW 11 3977795 splice site probably benign
R0883:Pes1 UTSW 11 3975557 missense probably damaging 1.00
R0980:Pes1 UTSW 11 3977636 small deletion probably benign
R1435:Pes1 UTSW 11 3976075 missense probably benign 0.00
R1557:Pes1 UTSW 11 3976824 missense probably damaging 1.00
R1694:Pes1 UTSW 11 3977719 small deletion probably benign
R1885:Pes1 UTSW 11 3969482 missense probably damaging 1.00
R1929:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2270:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2272:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2362:Pes1 UTSW 11 3977123 missense probably damaging 1.00
R2869:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2869:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2870:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2870:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2871:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2871:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2873:Pes1 UTSW 11 3976834 missense probably benign 0.05
R3024:Pes1 UTSW 11 3977719 small deletion probably benign
R3039:Pes1 UTSW 11 3975547 missense probably damaging 1.00
R3195:Pes1 UTSW 11 3975736 splice site probably benign
R3773:Pes1 UTSW 11 3975548 missense probably damaging 1.00
R4590:Pes1 UTSW 11 3977986 missense probably damaging 1.00
R4739:Pes1 UTSW 11 3964058 missense probably damaging 1.00
R5396:Pes1 UTSW 11 3977719 small deletion probably benign
R6016:Pes1 UTSW 11 3978004 missense possibly damaging 0.68
R6921:Pes1 UTSW 11 3973330 missense probably damaging 0.98
R7315:Pes1 UTSW 11 3976085 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATGAAGTAACGAGCTGTACAG -3'
(R):5'- CTGGCATGAACCACAAAGGC -3'

Sequencing Primer
(F):5'- CTGTACAGCAGTGGTAGGAGCTC -3'
(R):5'- CATGAACCACAAAGGCGGCTG -3'
Posted On2018-04-27