Incidental Mutation 'R6351:Zfyve21'
ID514278
Institutional Source Beutler Lab
Gene Symbol Zfyve21
Ensembl Gene ENSMUSG00000021286
Gene Namezinc finger, FYVE domain containing 21
SynonymsC85416, 1110013H04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6351 (G1)
Quality Score118.008
Status Validated
Chromosome12
Chromosomal Location111814170-111832192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111827594 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 212 (A212E)
Ref Sequence ENSEMBL: ENSMUSP00000152422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021714] [ENSMUST00000054815] [ENSMUST00000220486] [ENSMUST00000220616] [ENSMUST00000221375] [ENSMUST00000222843]
Predicted Effect probably benign
Transcript: ENSMUST00000021714
AA Change: A193E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000021714
Gene: ENSMUSG00000021286
AA Change: A193E

DomainStartEndE-ValueType
FYVE 36 105 7.11e-16 SMART
Pfam:ZFYVE21_C 108 233 1.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054815
SMART Domains Protein: ENSMUSP00000062464
Gene: ENSMUSG00000021285

DomainStartEndE-ValueType
PDB:2UWQ|A 1 83 8e-35 PDB
Blast:RA 5 84 3e-47 BLAST
coiled coil region 123 305 N/A INTRINSIC
low complexity region 437 476 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
PDB:4IRV|H 695 741 1e-12 PDB
ANK 917 946 4.16e-7 SMART
ANK 950 979 4.63e-5 SMART
SH3 1019 1077 1.79e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220486
Predicted Effect probably benign
Transcript: ENSMUST00000220616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221313
Predicted Effect probably benign
Transcript: ENSMUST00000221375
AA Change: A212E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221488
Predicted Effect probably benign
Transcript: ENSMUST00000222843
Predicted Effect unknown
Transcript: ENSMUST00000223211
AA Change: A221E
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik C T 19: 11,142,401 G14D probably damaging Het
4932438A13Rik G A 3: 36,908,228 A493T probably damaging Het
Acaa1a C A 9: 119,341,564 S17* probably null Het
Adamts16 T A 13: 70,836,203 S114C probably damaging Het
Agpat5 T C 8: 18,846,708 V50A probably benign Het
Agrn T C 4: 156,179,434 N124S probably benign Het
AI481877 T C 4: 59,069,317 D703G probably benign Het
Ak8 T C 2: 28,735,626 I227T probably benign Het
Akap6 A G 12: 53,142,025 E2074G probably damaging Het
Apc T A 18: 34,312,212 S702R probably damaging Het
Ascc3 T C 10: 50,720,673 I1233T probably damaging Het
Asphd2 A T 5: 112,385,832 F318I probably damaging Het
Bnc2 T C 4: 84,293,143 T397A probably benign Het
Bpifb4 C T 2: 153,957,134 T528I probably damaging Het
Brinp3 A G 1: 146,901,585 E590G probably damaging Het
Ccdc149 A G 5: 52,385,135 S372P probably benign Het
Cdhr2 A G 13: 54,726,776 H887R probably benign Het
Clcn6 C T 4: 148,017,500 V376I probably benign Het
Cntln T G 4: 85,115,354 C1305W probably damaging Het
Cspg4 A G 9: 56,892,644 D1564G probably benign Het
Cux1 A T 5: 136,309,792 S582T probably damaging Het
Cwh43 G A 5: 73,411,905 A97T possibly damaging Het
Dsc1 A T 18: 20,086,769 F781L probably damaging Het
Dsc3 G T 18: 19,966,291 H723N probably benign Het
Ear10 A T 14: 43,923,055 V105D probably damaging Het
Ecel1 A G 1: 87,149,509 V659A possibly damaging Het
Eogt A T 6: 97,120,194 F316I probably damaging Het
Etaa1 T C 11: 17,947,188 N310D possibly damaging Het
Exoc3l2 G A 7: 19,469,708 R75Q possibly damaging Het
Fam186a A C 15: 99,941,742 L2207R probably damaging Het
Fam187b T C 7: 30,977,599 Y178H probably damaging Het
Fat1 A T 8: 45,033,495 Q3362L probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fsip2 G A 2: 82,992,684 V6254I possibly damaging Het
Gabra5 T C 7: 57,413,780 T299A probably damaging Het
Gbp11 T C 5: 105,327,598 T295A probably benign Het
Glcci1 C T 6: 8,573,203 Q44* probably null Het
Gpc5 A T 14: 115,399,200 T432S probably benign Het
Grhl1 G A 12: 24,584,858 E228K probably damaging Het
Hyal5 T C 6: 24,891,709 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints9 A G 14: 64,993,007 I128V probably damaging Het
Kcnt2 A T 1: 140,375,112 N130I probably damaging Het
Krba1 T C 6: 48,414,128 V717A probably benign Het
Lrp12 T A 15: 39,878,188 D377V probably damaging Het
Magi1 G T 6: 93,943,229 D135E possibly damaging Het
Map10 T A 8: 125,671,245 L459Q probably damaging Het
Mitf A G 6: 98,003,912 D238G possibly damaging Het
Mylk G T 16: 34,921,971 R951L probably benign Het
Nacad T A 11: 6,599,235 D1272V probably damaging Het
Nacad T A 11: 6,600,165 K1009* probably null Het
Ncor1 T C 11: 62,373,298 D786G probably benign Het
Oas2 G A 5: 120,748,538 R188C probably benign Het
Odf2l A G 3: 145,135,718 I300V probably benign Het
Olfr1502 A G 19: 13,861,822 T10A probably benign Het
Olfr338 T A 2: 36,377,196 V140D possibly damaging Het
Olfr484 A G 7: 108,124,430 S278P probably damaging Het
Olfr624 A G 7: 103,670,956 I25T possibly damaging Het
Olfr64 A T 7: 103,893,135 L200* probably null Het
Pes1 T A 11: 3,978,865 D574E probably benign Het
Phf20 C T 2: 156,294,210 R650C possibly damaging Het
Pias4 G A 10: 81,157,264 T248I probably damaging Het
Pkhd1 T C 1: 20,211,951 T2889A probably benign Het
Plcxd1 C A 5: 110,102,167 probably null Het
Plekha7 A G 7: 116,176,898 F194L probably damaging Het
Plxnb2 T C 15: 89,157,770 N1642S possibly damaging Het
Pnpla7 A T 2: 25,011,564 D534V probably damaging Het
Ppp2r5c A T 12: 110,554,879 S279C probably damaging Het
Ptprq T A 10: 107,708,668 T334S probably damaging Het
Rab39 T C 9: 53,686,521 D148G probably benign Het
Reep3 A T 10: 67,034,653 F121L probably benign Het
Reln G T 5: 21,901,663 C3236* probably null Het
Rrp8 C T 7: 105,734,809 C162Y probably damaging Het
Scrib C A 15: 76,064,986 Q399H possibly damaging Het
Sertad1 T A 7: 27,489,799 Y182N possibly damaging Het
Sfrp5 A G 19: 42,201,824 V63A possibly damaging Het
Slc46a1 T C 11: 78,467,159 M346T probably benign Het
Sycp2 A G 2: 178,363,416 L886S probably damaging Het
Teddm1b A T 1: 153,874,759 I105F probably benign Het
Thumpd1 A T 7: 119,720,605 I46N possibly damaging Het
Tmod4 A G 3: 95,127,853 N223S probably damaging Het
Tnfrsf10b G C 14: 69,773,401 C85S probably damaging Het
Tox T C 4: 6,697,439 T455A probably benign Het
Tox T C 4: 6,741,536 Q148R probably benign Het
Trp53bp1 A C 2: 121,269,945 S109R probably damaging Het
Tshz2 A T 2: 169,884,968 T26S probably benign Het
Tubb4a T A 17: 57,081,016 N337Y probably damaging Het
Tubb6 T A 18: 67,401,388 V119E probably damaging Het
Unk C T 11: 116,054,946 T481I probably benign Het
Vmn2r112 C T 17: 22,601,278 T44I probably benign Het
Vstm5 G A 9: 15,257,533 G131D probably damaging Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp369 T A 13: 65,296,230 S396T possibly damaging Het
Zfp932 T A 5: 110,009,343 C302* probably null Het
Zfp972 A T 2: 177,906,935 probably null Het
Other mutations in Zfyve21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Zfyve21 APN 12 111824934 splice site probably benign
IGL01618:Zfyve21 APN 12 111827813 splice site probably benign
IGL02729:Zfyve21 APN 12 111825051 missense probably benign 0.01
R0513:Zfyve21 UTSW 12 111823264 missense possibly damaging 0.65
R1813:Zfyve21 UTSW 12 111824894 missense probably damaging 0.99
R7355:Zfyve21 UTSW 12 111825051 missense possibly damaging 0.94
R7514:Zfyve21 UTSW 12 111823815 missense probably damaging 1.00
T0975:Zfyve21 UTSW 12 111827633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATATGGCCCTGGGGATCAC -3'
(R):5'- GCGGAACACCATAAATCATGAG -3'

Sequencing Primer
(F):5'- GGGATCACAAGCTGAGTTTATTCCTC -3'
(R):5'- CCATAAATCATGAGTGGTTCTGTGCC -3'
Posted On2018-04-27