Incidental Mutation 'R6351:Cdhr2'
ID514279
Institutional Source Beutler Lab
Gene Symbol Cdhr2
Ensembl Gene ENSMUSG00000034918
Gene Namecadherin-related family member 2
SynonymsLOC268663, Pcdh24
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6351 (G1)
Quality Score138.008
Status Validated
Chromosome13
Chromosomal Location54701461-54736662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54726776 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 887 (H887R)
Ref Sequence ENSEMBL: ENSMUSP00000043596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037145]
Predicted Effect probably benign
Transcript: ENSMUST00000037145
AA Change: H887R

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043596
Gene: ENSMUSG00000034918
AA Change: H887R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 48 122 8.62e-15 SMART
CA 146 239 1.4e-2 SMART
CA 263 351 2.19e-16 SMART
CA 391 478 4.22e-9 SMART
CA 503 584 2.15e-24 SMART
CA 605 693 6.78e-22 SMART
CA 715 805 1.78e-16 SMART
CA 830 925 7.57e-11 SMART
CA 950 1042 7.1e-2 SMART
low complexity region 1121 1147 N/A INTRINSIC
transmembrane domain 1153 1175 N/A INTRINSIC
low complexity region 1195 1209 N/A INTRINSIC
low complexity region 1234 1250 N/A INTRINSIC
low complexity region 1264 1277 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin family, which represents a subset of the larger cadherin superfamily. The members of the protocadherin family encode non-classical cadherins that function as calcium-dependent cell-cell adhesion molecules. This protocadherin represents a new candidate for tumor suppression. Alternatively spliced transcript variants that encode the same protein have been identified. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik C T 19: 11,142,401 G14D probably damaging Het
4932438A13Rik G A 3: 36,908,228 A493T probably damaging Het
Acaa1a C A 9: 119,341,564 S17* probably null Het
Adamts16 T A 13: 70,836,203 S114C probably damaging Het
Agpat5 T C 8: 18,846,708 V50A probably benign Het
Agrn T C 4: 156,179,434 N124S probably benign Het
AI481877 T C 4: 59,069,317 D703G probably benign Het
Ak8 T C 2: 28,735,626 I227T probably benign Het
Akap6 A G 12: 53,142,025 E2074G probably damaging Het
Apc T A 18: 34,312,212 S702R probably damaging Het
Ascc3 T C 10: 50,720,673 I1233T probably damaging Het
Asphd2 A T 5: 112,385,832 F318I probably damaging Het
Bnc2 T C 4: 84,293,143 T397A probably benign Het
Bpifb4 C T 2: 153,957,134 T528I probably damaging Het
Brinp3 A G 1: 146,901,585 E590G probably damaging Het
Ccdc149 A G 5: 52,385,135 S372P probably benign Het
Clcn6 C T 4: 148,017,500 V376I probably benign Het
Cntln T G 4: 85,115,354 C1305W probably damaging Het
Cspg4 A G 9: 56,892,644 D1564G probably benign Het
Cux1 A T 5: 136,309,792 S582T probably damaging Het
Cwh43 G A 5: 73,411,905 A97T possibly damaging Het
Dsc1 A T 18: 20,086,769 F781L probably damaging Het
Dsc3 G T 18: 19,966,291 H723N probably benign Het
Ear10 A T 14: 43,923,055 V105D probably damaging Het
Ecel1 A G 1: 87,149,509 V659A possibly damaging Het
Eogt A T 6: 97,120,194 F316I probably damaging Het
Etaa1 T C 11: 17,947,188 N310D possibly damaging Het
Exoc3l2 G A 7: 19,469,708 R75Q possibly damaging Het
Fam186a A C 15: 99,941,742 L2207R probably damaging Het
Fam187b T C 7: 30,977,599 Y178H probably damaging Het
Fat1 A T 8: 45,033,495 Q3362L probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fsip2 G A 2: 82,992,684 V6254I possibly damaging Het
Gabra5 T C 7: 57,413,780 T299A probably damaging Het
Gbp11 T C 5: 105,327,598 T295A probably benign Het
Glcci1 C T 6: 8,573,203 Q44* probably null Het
Gpc5 A T 14: 115,399,200 T432S probably benign Het
Grhl1 G A 12: 24,584,858 E228K probably damaging Het
Hyal5 T C 6: 24,891,709 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ints9 A G 14: 64,993,007 I128V probably damaging Het
Kcnt2 A T 1: 140,375,112 N130I probably damaging Het
Krba1 T C 6: 48,414,128 V717A probably benign Het
Lrp12 T A 15: 39,878,188 D377V probably damaging Het
Magi1 G T 6: 93,943,229 D135E possibly damaging Het
Map10 T A 8: 125,671,245 L459Q probably damaging Het
Mitf A G 6: 98,003,912 D238G possibly damaging Het
Mylk G T 16: 34,921,971 R951L probably benign Het
Nacad T A 11: 6,599,235 D1272V probably damaging Het
Nacad T A 11: 6,600,165 K1009* probably null Het
Ncor1 T C 11: 62,373,298 D786G probably benign Het
Oas2 G A 5: 120,748,538 R188C probably benign Het
Odf2l A G 3: 145,135,718 I300V probably benign Het
Olfr1502 A G 19: 13,861,822 T10A probably benign Het
Olfr338 T A 2: 36,377,196 V140D possibly damaging Het
Olfr484 A G 7: 108,124,430 S278P probably damaging Het
Olfr624 A G 7: 103,670,956 I25T possibly damaging Het
Olfr64 A T 7: 103,893,135 L200* probably null Het
Pes1 T A 11: 3,978,865 D574E probably benign Het
Phf20 C T 2: 156,294,210 R650C possibly damaging Het
Pias4 G A 10: 81,157,264 T248I probably damaging Het
Pkhd1 T C 1: 20,211,951 T2889A probably benign Het
Plcxd1 C A 5: 110,102,167 probably null Het
Plekha7 A G 7: 116,176,898 F194L probably damaging Het
Plxnb2 T C 15: 89,157,770 N1642S possibly damaging Het
Pnpla7 A T 2: 25,011,564 D534V probably damaging Het
Ppp2r5c A T 12: 110,554,879 S279C probably damaging Het
Ptprq T A 10: 107,708,668 T334S probably damaging Het
Rab39 T C 9: 53,686,521 D148G probably benign Het
Reep3 A T 10: 67,034,653 F121L probably benign Het
Reln G T 5: 21,901,663 C3236* probably null Het
Rrp8 C T 7: 105,734,809 C162Y probably damaging Het
Scrib C A 15: 76,064,986 Q399H possibly damaging Het
Sertad1 T A 7: 27,489,799 Y182N possibly damaging Het
Sfrp5 A G 19: 42,201,824 V63A possibly damaging Het
Slc46a1 T C 11: 78,467,159 M346T probably benign Het
Sycp2 A G 2: 178,363,416 L886S probably damaging Het
Teddm1b A T 1: 153,874,759 I105F probably benign Het
Thumpd1 A T 7: 119,720,605 I46N possibly damaging Het
Tmod4 A G 3: 95,127,853 N223S probably damaging Het
Tnfrsf10b G C 14: 69,773,401 C85S probably damaging Het
Tox T C 4: 6,697,439 T455A probably benign Het
Tox T C 4: 6,741,536 Q148R probably benign Het
Trp53bp1 A C 2: 121,269,945 S109R probably damaging Het
Tshz2 A T 2: 169,884,968 T26S probably benign Het
Tubb4a T A 17: 57,081,016 N337Y probably damaging Het
Tubb6 T A 18: 67,401,388 V119E probably damaging Het
Unk C T 11: 116,054,946 T481I probably benign Het
Vmn2r112 C T 17: 22,601,278 T44I probably benign Het
Vstm5 G A 9: 15,257,533 G131D probably damaging Het
Wscd1 T C 11: 71,759,883 L12P probably damaging Het
Zfp369 T A 13: 65,296,230 S396T possibly damaging Het
Zfp932 T A 5: 110,009,343 C302* probably null Het
Zfp972 A T 2: 177,906,935 probably null Het
Zfyve21 C A 12: 111,827,594 A212E probably benign Het
Other mutations in Cdhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Cdhr2 APN 13 54718299 missense probably damaging 1.00
IGL00596:Cdhr2 APN 13 54720997 missense probably damaging 0.97
IGL00840:Cdhr2 APN 13 54720152 missense probably damaging 0.96
IGL00956:Cdhr2 APN 13 54718343 missense probably damaging 1.00
IGL01101:Cdhr2 APN 13 54718135 splice site probably benign
IGL01150:Cdhr2 APN 13 54731118 missense probably benign
IGL01412:Cdhr2 APN 13 54725894 missense probably damaging 1.00
IGL01515:Cdhr2 APN 13 54718238 missense probably benign 0.17
IGL02005:Cdhr2 APN 13 54719763 missense probably benign 0.00
IGL02187:Cdhr2 APN 13 54733710 missense possibly damaging 0.86
IGL02312:Cdhr2 APN 13 54717888 missense probably null 0.97
IGL02877:Cdhr2 APN 13 54734737 missense probably benign 0.39
IGL03072:Cdhr2 APN 13 54726661 missense probably benign 0.00
IGL03263:Cdhr2 APN 13 54718113 missense possibly damaging 0.75
FR4449:Cdhr2 UTSW 13 54725924 small insertion probably benign
PIT4494001:Cdhr2 UTSW 13 54718442 critical splice acceptor site probably null
PIT4498001:Cdhr2 UTSW 13 54718239 missense possibly damaging 0.75
R0041:Cdhr2 UTSW 13 54726838 missense probably damaging 1.00
R0149:Cdhr2 UTSW 13 54734007 missense probably damaging 1.00
R0329:Cdhr2 UTSW 13 54734801 unclassified probably benign
R0361:Cdhr2 UTSW 13 54734007 missense probably damaging 1.00
R0365:Cdhr2 UTSW 13 54718292 missense probably benign 0.00
R0598:Cdhr2 UTSW 13 54726739 missense probably damaging 1.00
R0774:Cdhr2 UTSW 13 54717855 missense probably damaging 1.00
R1330:Cdhr2 UTSW 13 54734268 missense possibly damaging 0.67
R1458:Cdhr2 UTSW 13 54717872 missense probably damaging 0.99
R1659:Cdhr2 UTSW 13 54719761 missense probably damaging 1.00
R1698:Cdhr2 UTSW 13 54719581 missense probably benign 0.00
R2061:Cdhr2 UTSW 13 54720818 missense probably damaging 1.00
R2098:Cdhr2 UTSW 13 54715644 missense probably benign 0.15
R2135:Cdhr2 UTSW 13 54720947 missense probably damaging 1.00
R2365:Cdhr2 UTSW 13 54718088 missense probably benign 0.01
R3693:Cdhr2 UTSW 13 54726416 missense probably damaging 1.00
R3968:Cdhr2 UTSW 13 54726458 missense probably damaging 1.00
R3970:Cdhr2 UTSW 13 54726458 missense probably damaging 1.00
R4001:Cdhr2 UTSW 13 54718266 missense probably benign 0.09
R4003:Cdhr2 UTSW 13 54718266 missense probably benign 0.09
R4030:Cdhr2 UTSW 13 54717861 missense probably damaging 1.00
R4088:Cdhr2 UTSW 13 54717888 missense probably null 0.97
R4256:Cdhr2 UTSW 13 54714005 missense probably damaging 0.99
R4322:Cdhr2 UTSW 13 54733721 missense probably benign 0.00
R4396:Cdhr2 UTSW 13 54715665 missense probably damaging 0.99
R4591:Cdhr2 UTSW 13 54715684 missense probably benign 0.18
R4726:Cdhr2 UTSW 13 54718539 missense probably damaging 0.99
R5370:Cdhr2 UTSW 13 54720887 missense probably damaging 1.00
R5396:Cdhr2 UTSW 13 54736456 missense probably benign
R5447:Cdhr2 UTSW 13 54733250 missense probably damaging 1.00
R5654:Cdhr2 UTSW 13 54736536 missense probably benign
R5727:Cdhr2 UTSW 13 54724308 missense possibly damaging 0.95
R5771:Cdhr2 UTSW 13 54726695 missense probably damaging 0.99
R5924:Cdhr2 UTSW 13 54726683 missense probably benign 0.01
R5928:Cdhr2 UTSW 13 54734019 missense probably benign 0.01
R6246:Cdhr2 UTSW 13 54719710 missense probably damaging 1.00
R6358:Cdhr2 UTSW 13 54736546 missense probably damaging 0.99
R6433:Cdhr2 UTSW 13 54718512 missense probably damaging 0.97
R7044:Cdhr2 UTSW 13 54733321 nonsense probably null
R7341:Cdhr2 UTSW 13 54719492 missense probably damaging 0.99
R7462:Cdhr2 UTSW 13 54726739 missense probably damaging 1.00
R7488:Cdhr2 UTSW 13 54717915 missense probably benign 0.28
R7763:Cdhr2 UTSW 13 54717692 missense probably damaging 1.00
R7771:Cdhr2 UTSW 13 54718275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGACTGAGAATGGCTCTG -3'
(R):5'- ACTCCCCACTGGACAGATAG -3'

Sequencing Primer
(F):5'- TGAGCATGGCCAGGTGACTC -3'
(R):5'- CCCACTGGACAGATAGAGAACAG -3'
Posted On2018-04-27