Incidental Mutation 'R6351:Mylk'
ID 514290
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6351 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 34565580-34822790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 34742341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 951 (R951L)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: R951L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: R951L

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232482
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a C A 9: 119,170,630 (GRCm39) S17* probably null Het
Adamts16 T A 13: 70,984,322 (GRCm39) S114C probably damaging Het
Agpat5 T C 8: 18,896,724 (GRCm39) V50A probably benign Het
Agrn T C 4: 156,263,891 (GRCm39) N124S probably benign Het
Ak8 T C 2: 28,625,638 (GRCm39) I227T probably benign Het
Akap6 A G 12: 53,188,808 (GRCm39) E2074G probably damaging Het
Apc T A 18: 34,445,265 (GRCm39) S702R probably damaging Het
Ascc3 T C 10: 50,596,769 (GRCm39) I1233T probably damaging Het
Asphd2 A T 5: 112,533,698 (GRCm39) F318I probably damaging Het
Bltp1 G A 3: 36,962,377 (GRCm39) A493T probably damaging Het
Bnc2 T C 4: 84,211,380 (GRCm39) T397A probably benign Het
Bpifb4 C T 2: 153,799,054 (GRCm39) T528I probably damaging Het
Brinp3 A G 1: 146,777,323 (GRCm39) E590G probably damaging Het
Ccdc149 A G 5: 52,542,477 (GRCm39) S372P probably benign Het
Cdhr2 A G 13: 54,874,589 (GRCm39) H887R probably benign Het
Clcn6 C T 4: 148,101,957 (GRCm39) V376I probably benign Het
Cntln T G 4: 85,033,591 (GRCm39) C1305W probably damaging Het
Cspg4 A G 9: 56,799,928 (GRCm39) D1564G probably benign Het
Cux1 A T 5: 136,338,646 (GRCm39) S582T probably damaging Het
Cwh43 G A 5: 73,569,248 (GRCm39) A97T possibly damaging Het
Dsc1 A T 18: 20,219,826 (GRCm39) F781L probably damaging Het
Dsc3 G T 18: 20,099,348 (GRCm39) H723N probably benign Het
Ear10 A T 14: 44,160,512 (GRCm39) V105D probably damaging Het
Ecel1 A G 1: 87,077,231 (GRCm39) V659A possibly damaging Het
Eogt A T 6: 97,097,155 (GRCm39) F316I probably damaging Het
Etaa1 T C 11: 17,897,188 (GRCm39) N310D possibly damaging Het
Exoc3l2 G A 7: 19,203,633 (GRCm39) R75Q possibly damaging Het
Fam186a A C 15: 99,839,623 (GRCm39) L2207R probably damaging Het
Fam187b T C 7: 30,677,024 (GRCm39) Y178H probably damaging Het
Fat1 A T 8: 45,486,532 (GRCm39) Q3362L probably damaging Het
Fat3 A T 9: 15,849,694 (GRCm39) S3903T probably damaging Het
Fsip2 G A 2: 82,823,028 (GRCm39) V6254I possibly damaging Het
Gabra5 T C 7: 57,063,528 (GRCm39) T299A probably damaging Het
Gbp11 T C 5: 105,475,464 (GRCm39) T295A probably benign Het
Glcci1 C T 6: 8,573,203 (GRCm39) Q44* probably null Het
Gpc5 A T 14: 115,636,612 (GRCm39) T432S probably benign Het
Grhl1 G A 12: 24,634,857 (GRCm39) E228K probably damaging Het
Hyal5 T C 6: 24,891,708 (GRCm39) probably null Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Ints9 A G 14: 65,230,456 (GRCm39) I128V probably damaging Het
Kcnt2 A T 1: 140,302,850 (GRCm39) N130I probably damaging Het
Krba1 T C 6: 48,391,062 (GRCm39) V717A probably benign Het
Lrp12 T A 15: 39,741,584 (GRCm39) D377V probably damaging Het
Magi1 G T 6: 93,920,210 (GRCm39) D135E possibly damaging Het
Map10 T A 8: 126,397,984 (GRCm39) L459Q probably damaging Het
Mitf A G 6: 97,980,873 (GRCm39) D238G possibly damaging Het
Ms4a19 C T 19: 11,119,765 (GRCm39) G14D probably damaging Het
Nacad T A 11: 6,549,235 (GRCm39) D1272V probably damaging Het
Nacad T A 11: 6,550,165 (GRCm39) K1009* probably null Het
Ncor1 T C 11: 62,264,124 (GRCm39) D786G probably benign Het
Oas2 G A 5: 120,886,603 (GRCm39) R188C probably benign Het
Odf2l A G 3: 144,841,479 (GRCm39) I300V probably benign Het
Or1j10 T A 2: 36,267,208 (GRCm39) V140D possibly damaging Het
Or51b17 A T 7: 103,542,342 (GRCm39) L200* probably null Het
Or51v8 A G 7: 103,320,163 (GRCm39) I25T possibly damaging Het
Or5p60 A G 7: 107,723,637 (GRCm39) S278P probably damaging Het
Or9i1 A G 19: 13,839,186 (GRCm39) T10A probably benign Het
Pes1 T A 11: 3,928,865 (GRCm39) D574E probably benign Het
Phf20 C T 2: 156,136,130 (GRCm39) R650C possibly damaging Het
Pias4 G A 10: 80,993,098 (GRCm39) T248I probably damaging Het
Pkhd1 T C 1: 20,282,175 (GRCm39) T2889A probably benign Het
Plcxd1 C A 5: 110,250,033 (GRCm39) probably null Het
Plekha7 A G 7: 115,776,133 (GRCm39) F194L probably damaging Het
Plxnb2 T C 15: 89,041,973 (GRCm39) N1642S possibly damaging Het
Pnpla7 A T 2: 24,901,576 (GRCm39) D534V probably damaging Het
Ppp2r5c A T 12: 110,521,313 (GRCm39) S279C probably damaging Het
Ptprq T A 10: 107,544,529 (GRCm39) T334S probably damaging Het
Rab39 T C 9: 53,597,821 (GRCm39) D148G probably benign Het
Reep3 A T 10: 66,870,432 (GRCm39) F121L probably benign Het
Reln G T 5: 22,106,661 (GRCm39) C3236* probably null Het
Rrp8 C T 7: 105,384,016 (GRCm39) C162Y probably damaging Het
Scrib C A 15: 75,936,835 (GRCm39) Q399H possibly damaging Het
Sertad1 T A 7: 27,189,224 (GRCm39) Y182N possibly damaging Het
Sfrp5 A G 19: 42,190,263 (GRCm39) V63A possibly damaging Het
Shoc1 T C 4: 59,069,317 (GRCm39) D703G probably benign Het
Slc46a1 T C 11: 78,357,985 (GRCm39) M346T probably benign Het
Sycp2 A G 2: 178,005,209 (GRCm39) L886S probably damaging Het
Teddm1b A T 1: 153,750,505 (GRCm39) I105F probably benign Het
Thumpd1 A T 7: 119,319,828 (GRCm39) I46N possibly damaging Het
Tmod4 A G 3: 95,035,164 (GRCm39) N223S probably damaging Het
Tnfrsf10b G C 14: 70,010,850 (GRCm39) C85S probably damaging Het
Tox T C 4: 6,697,439 (GRCm39) T455A probably benign Het
Tox T C 4: 6,741,536 (GRCm39) Q148R probably benign Het
Trp53bp1 A C 2: 121,100,426 (GRCm39) S109R probably damaging Het
Tshz2 A T 2: 169,726,888 (GRCm39) T26S probably benign Het
Tubb4a T A 17: 57,388,016 (GRCm39) N337Y probably damaging Het
Tubb6 T A 18: 67,534,458 (GRCm39) V119E probably damaging Het
Unk C T 11: 115,945,772 (GRCm39) T481I probably benign Het
Vmn2r112 C T 17: 22,820,259 (GRCm39) T44I probably benign Het
Vstm5 G A 9: 15,168,829 (GRCm39) G131D probably damaging Het
Wscd1 T C 11: 71,650,709 (GRCm39) L12P probably damaging Het
Zfp369 T A 13: 65,444,044 (GRCm39) S396T possibly damaging Het
Zfp932 T A 5: 110,157,209 (GRCm39) C302* probably null Het
Zfp972 A T 2: 177,548,728 (GRCm39) probably null Het
Zfyve21 C A 12: 111,794,028 (GRCm39) A212E probably benign Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34,759,322 (GRCm39) missense probably benign 0.36
IGL01386:Mylk APN 16 34,791,610 (GRCm39) critical splice acceptor site probably null
IGL01684:Mylk APN 16 34,792,310 (GRCm39) missense possibly damaging 0.55
IGL01884:Mylk APN 16 34,809,247 (GRCm39) splice site probably benign
IGL02079:Mylk APN 16 34,681,001 (GRCm39) missense possibly damaging 0.87
IGL02104:Mylk APN 16 34,635,805 (GRCm39) missense probably benign 0.06
IGL02624:Mylk APN 16 34,750,266 (GRCm39) missense probably benign 0.29
IGL02756:Mylk APN 16 34,784,016 (GRCm39) missense probably benign 0.42
IGL02794:Mylk APN 16 34,806,911 (GRCm39) missense probably benign 0.21
IGL02833:Mylk APN 16 34,735,270 (GRCm39) missense probably benign 0.01
IGL02946:Mylk APN 16 34,742,158 (GRCm39) missense probably benign 0.10
IGL03012:Mylk APN 16 34,773,151 (GRCm39) missense probably benign 0.03
IGL03093:Mylk APN 16 34,732,562 (GRCm39) missense possibly damaging 0.62
IGL03272:Mylk APN 16 34,799,559 (GRCm39) missense probably benign 0.09
billy UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
brutus UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
Club UTSW 16 34,732,645 (GRCm39) nonsense probably null
popeye UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
F5770:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34,797,483 (GRCm39) splice site probably benign
PIT4382001:Mylk UTSW 16 34,696,012 (GRCm39) missense probably damaging 0.99
R0131:Mylk UTSW 16 34,695,874 (GRCm39) missense probably benign 0.03
R0309:Mylk UTSW 16 34,732,667 (GRCm39) splice site probably benign
R0358:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0381:Mylk UTSW 16 34,605,344 (GRCm39) splice site probably null
R0390:Mylk UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
R0413:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.01
R0536:Mylk UTSW 16 34,820,757 (GRCm39) missense possibly damaging 0.95
R0544:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0545:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0546:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0547:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0548:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0627:Mylk UTSW 16 34,820,799 (GRCm39) missense probably damaging 1.00
R0726:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0755:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0782:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0783:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0784:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1136:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R1170:Mylk UTSW 16 34,694,409 (GRCm39) missense probably benign 0.20
R1222:Mylk UTSW 16 34,681,022 (GRCm39) missense probably benign 0.12
R1445:Mylk UTSW 16 34,635,835 (GRCm39) missense possibly damaging 0.57
R1583:Mylk UTSW 16 34,695,956 (GRCm39) missense probably benign 0.29
R1618:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1643:Mylk UTSW 16 34,696,005 (GRCm39) missense probably benign 0.03
R1702:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.00
R1776:Mylk UTSW 16 34,773,152 (GRCm39) missense probably benign 0.16
R1865:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.03
R1975:Mylk UTSW 16 34,700,673 (GRCm39) splice site probably null
R2016:Mylk UTSW 16 34,817,187 (GRCm39) missense probably damaging 1.00
R2045:Mylk UTSW 16 34,774,023 (GRCm39) missense probably benign 0.29
R2134:Mylk UTSW 16 34,806,846 (GRCm39) missense probably benign 0.13
R3547:Mylk UTSW 16 34,700,538 (GRCm39) missense possibly damaging 0.61
R3844:Mylk UTSW 16 34,742,247 (GRCm39) missense probably benign 0.01
R4003:Mylk UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
R4396:Mylk UTSW 16 34,732,645 (GRCm39) nonsense probably null
R4470:Mylk UTSW 16 34,732,522 (GRCm39) missense probably benign 0.09
R4507:Mylk UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
R4700:Mylk UTSW 16 34,742,805 (GRCm39) missense probably benign 0.16
R4751:Mylk UTSW 16 34,699,539 (GRCm39) missense probably benign 0.29
R4815:Mylk UTSW 16 34,715,295 (GRCm39) missense probably damaging 0.97
R4832:Mylk UTSW 16 34,742,737 (GRCm39) missense probably benign 0.36
R4872:Mylk UTSW 16 34,735,360 (GRCm39) missense possibly damaging 0.89
R4953:Mylk UTSW 16 34,809,331 (GRCm39) missense probably damaging 1.00
R4969:Mylk UTSW 16 34,791,810 (GRCm39) missense probably damaging 0.96
R5009:Mylk UTSW 16 34,719,877 (GRCm39) missense probably benign 0.39
R5130:Mylk UTSW 16 34,809,367 (GRCm39) missense probably damaging 1.00
R5173:Mylk UTSW 16 34,797,383 (GRCm39) missense probably benign 0.40
R5195:Mylk UTSW 16 34,799,585 (GRCm39) missense probably damaging 1.00
R5209:Mylk UTSW 16 34,742,995 (GRCm39) missense possibly damaging 0.55
R5311:Mylk UTSW 16 34,742,127 (GRCm39) missense probably benign 0.01
R5418:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.02
R5481:Mylk UTSW 16 34,741,974 (GRCm39) missense probably benign 0.09
R5590:Mylk UTSW 16 34,699,722 (GRCm39) missense probably benign 0.29
R5603:Mylk UTSW 16 34,776,862 (GRCm39) missense probably benign 0.06
R5823:Mylk UTSW 16 34,715,317 (GRCm39) critical splice donor site probably null
R6290:Mylk UTSW 16 34,715,213 (GRCm39) missense probably benign 0.39
R6365:Mylk UTSW 16 34,680,961 (GRCm39) missense probably benign 0.12
R6490:Mylk UTSW 16 34,750,237 (GRCm39) missense possibly damaging 0.74
R6723:Mylk UTSW 16 34,750,258 (GRCm39) missense possibly damaging 0.74
R6864:Mylk UTSW 16 34,694,520 (GRCm39) missense probably benign 0.03
R6908:Mylk UTSW 16 34,700,643 (GRCm39) missense probably benign 0.18
R6949:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R7018:Mylk UTSW 16 34,820,796 (GRCm39) missense possibly damaging 0.88
R7035:Mylk UTSW 16 34,797,352 (GRCm39) missense possibly damaging 0.89
R7162:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7236:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7269:Mylk UTSW 16 34,605,381 (GRCm39) missense probably damaging 0.96
R7475:Mylk UTSW 16 34,734,446 (GRCm39) splice site probably null
R7525:Mylk UTSW 16 34,809,357 (GRCm39) missense probably benign 0.06
R7587:Mylk UTSW 16 34,742,887 (GRCm39) missense probably benign 0.29
R7607:Mylk UTSW 16 34,715,184 (GRCm39) missense probably benign 0.09
R7616:Mylk UTSW 16 34,699,927 (GRCm39) missense probably damaging 0.97
R7647:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7648:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7764:Mylk UTSW 16 34,742,553 (GRCm39) missense probably benign 0.16
R7890:Mylk UTSW 16 34,784,018 (GRCm39) nonsense probably null
R7892:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7893:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R8065:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8067:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8143:Mylk UTSW 16 34,734,525 (GRCm39) missense possibly damaging 0.87
R8210:Mylk UTSW 16 34,820,721 (GRCm39) missense probably damaging 1.00
R8271:Mylk UTSW 16 34,742,949 (GRCm39) missense probably damaging 0.97
R8540:Mylk UTSW 16 34,750,257 (GRCm39) missense possibly damaging 0.87
R8721:Mylk UTSW 16 34,817,176 (GRCm39) missense probably damaging 1.00
R8743:Mylk UTSW 16 34,741,427 (GRCm39) missense probably benign 0.03
R8798:Mylk UTSW 16 34,719,772 (GRCm39) missense possibly damaging 0.89
R8956:Mylk UTSW 16 34,791,779 (GRCm39) missense probably benign 0.01
R9131:Mylk UTSW 16 34,776,835 (GRCm39) missense probably benign 0.29
R9403:Mylk UTSW 16 34,696,012 (GRCm39) nonsense probably null
R9624:Mylk UTSW 16 34,699,677 (GRCm39) missense probably benign 0.29
R9735:Mylk UTSW 16 34,735,179 (GRCm39) missense probably benign 0.09
R9756:Mylk UTSW 16 34,734,387 (GRCm39) missense probably damaging 0.96
R9763:Mylk UTSW 16 34,699,482 (GRCm39) nonsense probably null
RF001:Mylk UTSW 16 34,699,741 (GRCm39) missense probably benign 0.03
V7580:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
V7583:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
X0065:Mylk UTSW 16 34,820,811 (GRCm39) missense probably damaging 1.00
Z1177:Mylk UTSW 16 34,743,021 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GCTGGATTTTCGAGACCTCC -3'
(R):5'- ATTGCCTACGGGTTTCAGGG -3'

Sequencing Primer
(F):5'- ATTTTCGAGACCTCCTGGGAAAG -3'
(R):5'- ATCGCCTGCAGGTGTGG -3'
Posted On 2018-04-27