Incidental Mutation 'R6338:Gpatch2'
ID 514301
Institutional Source Beutler Lab
Gene Symbol Gpatch2
Ensembl Gene ENSMUSG00000039210
Gene Name G patch domain containing 2
Synonyms 5830433G22Rik, 5830436K05Rik, Gpatc2
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6338 (G1)
Quality Score 186.009
Status Not validated
Chromosome 1
Chromosomal Location 186947705-187083901 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 186957711 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 22 (R22L)
Ref Sequence ENSEMBL: ENSMUSP00000137858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044812] [ENSMUST00000065573] [ENSMUST00000110943] [ENSMUST00000159748] [ENSMUST00000160471] [ENSMUST00000160481] [ENSMUST00000160570]
AlphaFold Q7TQC7
Predicted Effect probably damaging
Transcript: ENSMUST00000044812
AA Change: R22L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048979
Gene: ENSMUSG00000039210
AA Change: R22L

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000065573
AA Change: R22L

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065009
Gene: ENSMUSG00000039210
AA Change: R22L

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
G_patch 464 510 3.95e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097443
SMART Domains Protein: ENSMUSP00000095052
Gene: ENSMUSG00000039210

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110943
AA Change: R22L

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106568
Gene: ENSMUSG00000039210
AA Change: R22L

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
G_patch 427 473 3.95e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159748
AA Change: R22L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137858
Gene: ENSMUSG00000039210
AA Change: R22L

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160471
SMART Domains Protein: ENSMUSP00000124407
Gene: ENSMUSG00000039210

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 84 95 N/A INTRINSIC
low complexity region 132 142 N/A INTRINSIC
low complexity region 182 191 N/A INTRINSIC
low complexity region 227 242 N/A INTRINSIC
G_patch 441 487 3.95e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160481
AA Change: R22L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137801
Gene: ENSMUSG00000039210
AA Change: R22L

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161260
Predicted Effect probably benign
Transcript: ENSMUST00000160570
SMART Domains Protein: ENSMUSP00000125750
Gene: ENSMUSG00000039210

DomainStartEndE-ValueType
G_patch 133 179 3.95e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. The encoded protein contains a G-patch domain with an RNA binding motif. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adam30 T G 3: 98,068,857 (GRCm39) I102S probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Agrn C T 4: 156,255,042 (GRCm39) E1614K probably benign Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arfgef2 A G 2: 166,687,490 (GRCm39) D238G probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cd209e T A 8: 3,899,154 (GRCm39) D186V probably damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cdh4 T C 2: 179,532,605 (GRCm39) V689A probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Csmd1 T G 8: 15,982,492 (GRCm39) K2725T possibly damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fam13a A G 6: 58,930,484 (GRCm39) V476A probably damaging Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Lrrcc1 T A 3: 14,612,376 (GRCm39) N376K possibly damaging Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1af1 A T 2: 37,109,834 (GRCm39) D111V probably damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Plcd1 G A 9: 118,904,059 (GRCm39) R292C probably damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Ubn2 A G 6: 38,467,649 (GRCm39) T788A probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Zc3h14 T A 12: 98,724,849 (GRCm39) D170E possibly damaging Het
Other mutations in Gpatch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Gpatch2 APN 1 186,962,991 (GRCm39) missense probably damaging 1.00
IGL02324:Gpatch2 APN 1 186,957,936 (GRCm39) missense probably damaging 1.00
IGL02493:Gpatch2 APN 1 186,965,325 (GRCm39) splice site probably benign
IGL02583:Gpatch2 APN 1 186,965,515 (GRCm39) splice site probably null
IGL02583:Gpatch2 APN 1 186,965,514 (GRCm39) splice site probably null
IGL02632:Gpatch2 APN 1 186,958,178 (GRCm39) missense probably damaging 1.00
R0100:Gpatch2 UTSW 1 186,958,014 (GRCm39) missense probably damaging 1.00
R1801:Gpatch2 UTSW 1 186,958,028 (GRCm39) missense probably benign 0.03
R1966:Gpatch2 UTSW 1 187,054,498 (GRCm39) missense probably damaging 1.00
R3870:Gpatch2 UTSW 1 187,054,491 (GRCm39) missense probably damaging 1.00
R4028:Gpatch2 UTSW 1 186,958,337 (GRCm39) missense possibly damaging 0.53
R4471:Gpatch2 UTSW 1 186,965,337 (GRCm39) missense probably damaging 1.00
R5346:Gpatch2 UTSW 1 186,958,065 (GRCm39) missense probably benign 0.00
R6936:Gpatch2 UTSW 1 186,965,433 (GRCm39) missense probably benign 0.04
R7185:Gpatch2 UTSW 1 186,958,394 (GRCm39) missense probably damaging 1.00
R7708:Gpatch2 UTSW 1 186,964,963 (GRCm39) missense probably benign
R7885:Gpatch2 UTSW 1 186,957,698 (GRCm39) critical splice acceptor site probably null
R8508:Gpatch2 UTSW 1 187,036,552 (GRCm39) missense probably benign 0.04
R9236:Gpatch2 UTSW 1 186,965,977 (GRCm39) missense probably benign 0.06
R9274:Gpatch2 UTSW 1 186,963,029 (GRCm39) missense probably damaging 1.00
R9647:Gpatch2 UTSW 1 187,054,542 (GRCm39) missense probably damaging 1.00
Z1177:Gpatch2 UTSW 1 186,957,888 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCAGATTGAAGCTGTCATCC -3'
(R):5'- AATCAGAGCCTTCACTTAAGCAG -3'

Sequencing Primer
(F):5'- GAAGCTGTCATCCTTTGAATAGTTC -3'
(R):5'- ACTTAAGCAGTGGCCTGTC -3'
Posted On 2018-04-27