Mutagenetix > Incidental Mutations

Incidental Mutation 'R6338:Olfr366'

514302

Institutional Source

Beutler Lab

Gene Symbol

Olfr366

Ensembl Gene

ENSMUSG00000068947

Gene Name

olfactory receptor 366

Synonyms

GA_x6K02T2NLDC-33902472-33903401, MOR138-6, MOR138-5P

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R6338 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37211574-37224506 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37219822 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 111 (D111V)

Ref Sequence

ENSEMBL: ENSMUSP00000150608 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091001] [ENSMUST00000214897]

Predicted Effect

probably damaging
Transcript: ENSMUST00000091001
AA Change: D111V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088524
Gene: ENSMUSG00000068947
AA Change: D111V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	5e-62	PFAM
Pfam:7tm_1	41	290	3.7e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214897
AA Change: D111V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer3	T	C	7: 98,257,715	Y128C	probably damaging	Het
Adam30	T	G	3: 98,161,541	I102S	probably damaging	Het
Adcy8	A	T	15: 64,920,617	D163E	possibly damaging	Het
Agrn	C	T	4: 156,170,585	E1614K	probably benign	Het
Aldh16a1	A	T	7: 45,141,961	W107R	probably damaging	Het
Arfgef2	A	G	2: 166,845,570	D238G	probably damaging	Het
Arhgap11a	T	C	2: 113,833,725	S738G	probably benign	Het
Arid5b	C	A	10: 68,098,561	G504*	probably null	Het
Carmil3	T	C	14: 55,499,849	V763A	possibly damaging	Het
Cd209e	T	A	8: 3,849,154	D186V	probably damaging	Het
Cdh23	T	C	10: 60,413,151	D882G	probably damaging	Het
Cdh4	T	C	2: 179,890,812	V689A	probably damaging	Het
Cntn6	T	A	6: 104,726,139	V174E	probably damaging	Het
Col7a1	C	T	9: 108,956,633	T390M	unknown	Het
Crybg1	T	C	10: 43,992,509	D1017G	probably damaging	Het
Csmd1	T	G	8: 15,932,492	K2725T	possibly damaging	Het
Dnaaf2	T	C	12: 69,198,122	E55G	probably damaging	Het
Fam13a	A	G	6: 58,953,499	V476A	probably damaging	Het
Fem1b	A	T	9: 62,797,011	D322E	probably benign	Het
Frmpd1	G	A	4: 45,274,489	V466I	probably benign	Het
Gm11639	C	T	11: 104,843,208	R2027*	probably null	Het
Gm20671	A	T	5: 32,820,647	D1794E	probably damaging	Het
Gpatch2	G	T	1: 187,225,514	R22L	probably damaging	Het
Gtf2h1	A	G	7: 46,816,456	T450A	probably benign	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Krit1	T	G	5: 3,836,857	M702R	probably benign	Het
Krt34	T	C	11: 100,038,490	N298S	probably benign	Het
Lrrcc1	T	A	3: 14,547,316	N376K	possibly damaging	Het
Myo15	A	G	11: 60,478,133	E573G	probably damaging	Het
Olfr1224-ps1	T	A	2: 89,156,371	K268I	probably damaging	Het
Olfr1390	A	G	11: 49,340,867	S112G	probably benign	Het
Olfr391-ps	A	T	11: 73,799,319	L146Q	possibly damaging	Het
Olfr661	T	A	7: 104,688,171	V52E	possibly damaging	Het
Olfr736	T	A	14: 50,393,400	F215I	possibly damaging	Het
Phf20	A	T	2: 156,273,686	Q309L	possibly damaging	Het
Plcd1	G	A	9: 119,074,991	R292C	probably damaging	Het
Pold3	A	G	7: 100,088,105	V342A	possibly damaging	Het
Polr2a	A	T	11: 69,739,679		probably null	Het
Ptprcap	A	G	19: 4,156,224	E102G	probably benign	Het
Rab11fip5	T	C	6: 85,341,378	E843G	possibly damaging	Het
Rai14	T	C	15: 10,574,976	D632G	probably damaging	Het
Rnf149	A	T	1: 39,560,742	C268S	probably null	Het
Slc6a13	T	A	6: 121,334,839	F392I	probably damaging	Het
Slc7a11	C	T	3: 50,384,043		probably null	Het
Slf1	T	A	13: 77,084,462		probably null	Het
Stard9	G	A	2: 120,697,485	V1408I	probably benign	Het
Suclg1	T	C	6: 73,264,246	I183T	probably damaging	Het
Syne1	T	C	10: 5,255,475	E3497G	probably benign	Het
Tax1bp1	C	T	6: 52,729,376	R121*	probably null	Het
Tdpoz2	C	T	3: 93,652,336	V110I	probably benign	Het
Ubn2	A	G	6: 38,490,714	T788A	probably benign	Het
Unc13c	T	A	9: 73,734,447	I1255F	probably damaging	Het
Usp44	G	T	10: 93,846,513	R275I	probably damaging	Het
Uspl1	A	G	5: 149,215,034	N1015D	probably benign	Het
Wbp2nl	G	T	15: 82,299,045	W13C	possibly damaging	Het
Zc3h14	T	A	12: 98,758,590	D170E	possibly damaging	Het

Other mutations in Olfr366

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01691:Olfr366	APN	2	37220026	missense	probably damaging	1.00
IGL01925:Olfr366	APN	2	37220046	missense	probably benign	0.14
IGL02355:Olfr366	APN	2	37219669	missense	probably damaging	1.00
IGL02362:Olfr366	APN	2	37219669	missense	probably damaging	1.00
IGL02671:Olfr366	APN	2	37220245	missense	probably damaging	1.00
IGL02821:Olfr366	APN	2	37220100	missense	probably damaging	1.00
R0603:Olfr366	UTSW	2	37220106	missense	probably damaging	1.00
R0707:Olfr366	UTSW	2	37220196	nonsense	probably null
R1204:Olfr366	UTSW	2	37219639	missense	probably benign
R1457:Olfr366	UTSW	2	37219659	missense	possibly damaging	0.95
R1509:Olfr366	UTSW	2	37219954	missense	probably damaging	1.00
R1676:Olfr366	UTSW	2	37219641	nonsense	probably null
R1823:Olfr366	UTSW	2	37220332	missense	probably damaging	0.96
R2163:Olfr366	UTSW	2	37220077	missense	probably damaging	1.00
R2909:Olfr366	UTSW	2	37220176	missense	probably damaging	0.98
R3696:Olfr366	UTSW	2	37220176	missense	probably damaging	0.98
R3698:Olfr366	UTSW	2	37220176	missense	probably damaging	0.98
R4004:Olfr366	UTSW	2	37219948	missense	probably benign	0.00
R4655:Olfr366	UTSW	2	37219873	missense	probably benign	0.03
R5311:Olfr366	UTSW	2	37219621	missense	probably benign	0.00
R5385:Olfr366	UTSW	2	37219587	missense	possibly damaging	0.77
R5433:Olfr366	UTSW	2	37219672	missense	probably damaging	1.00
R5499:Olfr366	UTSW	2	37219765	missense	possibly damaging	0.81
R5707:Olfr366	UTSW	2	37219889	missense	probably benign	0.00
R6330:Olfr366	UTSW	2	37220124	missense	probably benign	0.00
R6666:Olfr366	UTSW	2	37220319	missense	probably damaging	1.00
R6872:Olfr366	UTSW	2	37219977	missense	possibly damaging	0.60
R7412:Olfr366	UTSW	2	37219762	missense	possibly damaging	0.48
R7789:Olfr366	UTSW	2	37219660	missense	probably benign	0.01
R7831:Olfr366	UTSW	2	37219711	missense	probably damaging	0.98
R8220:Olfr366	UTSW	2	37219779	missense	probably benign	0.06
R8391:Olfr366	UTSW	2	37220265	missense	probably damaging	1.00
R8708:Olfr366	UTSW	2	37219944	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGAGATGCCCGACTACAC -3'
(R):5'- GTGGCTGGACATCACAAAAG -3'

Sequencing Primer
(F):5'- GATGCCCGACTACACACTCCTATG -3'
(R):5'- TGATGAATGACATTGGGTCCAC -3'

Posted On

2018-04-27