Incidental Mutation 'R6338:Or1af1'
ID 514302
Institutional Source Beutler Lab
Gene Symbol Or1af1
Ensembl Gene ENSMUSG00000068947
Gene Name olfactory receptor family 1 subfamily AF member 1
Synonyms Olfr366, MOR138-5P, MOR138-6, GA_x6K02T2NLDC-33902472-33903401
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R6338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 37109503-37110432 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37109834 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 111 (D111V)
Ref Sequence ENSEMBL: ENSMUSP00000150608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091001] [ENSMUST00000214897]
AlphaFold Q7TRY4
Predicted Effect probably damaging
Transcript: ENSMUST00000091001
AA Change: D111V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088524
Gene: ENSMUSG00000068947
AA Change: D111V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5e-62 PFAM
Pfam:7tm_1 41 290 3.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214897
AA Change: D111V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adam30 T G 3: 98,068,857 (GRCm39) I102S probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Agrn C T 4: 156,255,042 (GRCm39) E1614K probably benign Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arfgef2 A G 2: 166,687,490 (GRCm39) D238G probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cd209e T A 8: 3,899,154 (GRCm39) D186V probably damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cdh4 T C 2: 179,532,605 (GRCm39) V689A probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Csmd1 T G 8: 15,982,492 (GRCm39) K2725T possibly damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fam13a A G 6: 58,930,484 (GRCm39) V476A probably damaging Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gpatch2 G T 1: 186,957,711 (GRCm39) R22L probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Lrrcc1 T A 3: 14,612,376 (GRCm39) N376K possibly damaging Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Plcd1 G A 9: 118,904,059 (GRCm39) R292C probably damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Ubn2 A G 6: 38,467,649 (GRCm39) T788A probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Zc3h14 T A 12: 98,724,849 (GRCm39) D170E possibly damaging Het
Other mutations in Or1af1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Or1af1 APN 2 37,110,038 (GRCm39) missense probably damaging 1.00
IGL01925:Or1af1 APN 2 37,110,058 (GRCm39) missense probably benign 0.14
IGL02355:Or1af1 APN 2 37,109,681 (GRCm39) missense probably damaging 1.00
IGL02362:Or1af1 APN 2 37,109,681 (GRCm39) missense probably damaging 1.00
IGL02671:Or1af1 APN 2 37,110,257 (GRCm39) missense probably damaging 1.00
IGL02821:Or1af1 APN 2 37,110,112 (GRCm39) missense probably damaging 1.00
R0603:Or1af1 UTSW 2 37,110,118 (GRCm39) missense probably damaging 1.00
R0707:Or1af1 UTSW 2 37,110,208 (GRCm39) nonsense probably null
R1204:Or1af1 UTSW 2 37,109,651 (GRCm39) missense probably benign
R1457:Or1af1 UTSW 2 37,109,671 (GRCm39) missense possibly damaging 0.95
R1509:Or1af1 UTSW 2 37,109,966 (GRCm39) missense probably damaging 1.00
R1676:Or1af1 UTSW 2 37,109,653 (GRCm39) nonsense probably null
R1823:Or1af1 UTSW 2 37,110,344 (GRCm39) missense probably damaging 0.96
R2163:Or1af1 UTSW 2 37,110,089 (GRCm39) missense probably damaging 1.00
R2909:Or1af1 UTSW 2 37,110,188 (GRCm39) missense probably damaging 0.98
R3696:Or1af1 UTSW 2 37,110,188 (GRCm39) missense probably damaging 0.98
R3698:Or1af1 UTSW 2 37,110,188 (GRCm39) missense probably damaging 0.98
R4004:Or1af1 UTSW 2 37,109,960 (GRCm39) missense probably benign 0.00
R4655:Or1af1 UTSW 2 37,109,885 (GRCm39) missense probably benign 0.03
R5311:Or1af1 UTSW 2 37,109,633 (GRCm39) missense probably benign 0.00
R5385:Or1af1 UTSW 2 37,109,599 (GRCm39) missense possibly damaging 0.77
R5433:Or1af1 UTSW 2 37,109,684 (GRCm39) missense probably damaging 1.00
R5499:Or1af1 UTSW 2 37,109,777 (GRCm39) missense possibly damaging 0.81
R5707:Or1af1 UTSW 2 37,109,901 (GRCm39) missense probably benign 0.00
R6330:Or1af1 UTSW 2 37,110,136 (GRCm39) missense probably benign 0.00
R6666:Or1af1 UTSW 2 37,110,331 (GRCm39) missense probably damaging 1.00
R6872:Or1af1 UTSW 2 37,109,989 (GRCm39) missense possibly damaging 0.60
R7412:Or1af1 UTSW 2 37,109,774 (GRCm39) missense possibly damaging 0.48
R7789:Or1af1 UTSW 2 37,109,672 (GRCm39) missense probably benign 0.01
R7831:Or1af1 UTSW 2 37,109,723 (GRCm39) missense probably damaging 0.98
R8220:Or1af1 UTSW 2 37,109,791 (GRCm39) missense probably benign 0.06
R8391:Or1af1 UTSW 2 37,110,277 (GRCm39) missense probably damaging 1.00
R8708:Or1af1 UTSW 2 37,109,956 (GRCm39) missense probably damaging 1.00
R9049:Or1af1 UTSW 2 37,109,959 (GRCm39) missense probably damaging 0.98
R9231:Or1af1 UTSW 2 37,109,989 (GRCm39) missense possibly damaging 0.60
R9294:Or1af1 UTSW 2 37,110,122 (GRCm39) missense possibly damaging 0.63
R9471:Or1af1 UTSW 2 37,110,400 (GRCm39) missense probably damaging 1.00
R9595:Or1af1 UTSW 2 37,110,281 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAGATGCCCGACTACAC -3'
(R):5'- GTGGCTGGACATCACAAAAG -3'

Sequencing Primer
(F):5'- GATGCCCGACTACACACTCCTATG -3'
(R):5'- TGATGAATGACATTGGGTCCAC -3'
Posted On 2018-04-27