Mutagenetix > Incidental Mutation

Incidental Mutation 'R6338:Arfgef2'

514307

Institutional Source

Beutler Lab

Gene Symbol

Arfgef2

Ensembl Gene

ENSMUSG00000074582

Gene Name

ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)

Synonyms

E230011G24Rik, BIG2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.338) question?

Stock #

R6338 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

166805588-166898052 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 166845570 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 238 (D238G)

Ref Sequence

ENSEMBL: ENSMUSP00000131572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099078] [ENSMUST00000144847]

AlphaFold

A2A5R2

Predicted Effect

probably benign
Transcript: ENSMUST00000099078
AA Change: D350G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000096677
Gene: ENSMUSG00000074582
AA Change: D350G

Domain	Start	End	E-Value	Type
Pfam:DCB	7	200	1.6e-40	PFAM
Pfam:Sec7_N	377	536	3.7e-53	PFAM
Blast:Sec7	549	598	8e-18	BLAST
low complexity region	621	633	N/A	INTRINSIC
Sec7	647	834	1.55e-97	SMART
Blast:Sec7	853	888	2e-11	BLAST
Blast:Sec7	902	941	4e-15	BLAST
low complexity region	1044	1055	N/A	INTRINSIC
Pfam:DUF1981	1174	1257	6e-38	PFAM
low complexity region	1719	1729	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000144847
AA Change: D238G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP and is involved in Golgi transport. It contains a Sec7 domain, which may be responsible for its guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exencephaly, midline gut closure defects, periventricular and subependymal heterotopia, and impaired neuronal migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer3	T	C	7: 98,257,715	Y128C	probably damaging	Het
Adam30	T	G	3: 98,161,541	I102S	probably damaging	Het
Adcy8	A	T	15: 64,920,617	D163E	possibly damaging	Het
Agrn	C	T	4: 156,170,585	E1614K	probably benign	Het
Aldh16a1	A	T	7: 45,141,961	W107R	probably damaging	Het
Arhgap11a	T	C	2: 113,833,725	S738G	probably benign	Het
Arid5b	C	A	10: 68,098,561	G504*	probably null	Het
Carmil3	T	C	14: 55,499,849	V763A	possibly damaging	Het
Cd209e	T	A	8: 3,849,154	D186V	probably damaging	Het
Cdh23	T	C	10: 60,413,151	D882G	probably damaging	Het
Cdh4	T	C	2: 179,890,812	V689A	probably damaging	Het
Cntn6	T	A	6: 104,726,139	V174E	probably damaging	Het
Col7a1	C	T	9: 108,956,633	T390M	unknown	Het
Crybg1	T	C	10: 43,992,509	D1017G	probably damaging	Het
Csmd1	T	G	8: 15,932,492	K2725T	possibly damaging	Het
Dnaaf2	T	C	12: 69,198,122	E55G	probably damaging	Het
Fam13a	A	G	6: 58,953,499	V476A	probably damaging	Het
Fem1b	A	T	9: 62,797,011	D322E	probably benign	Het
Frmpd1	G	A	4: 45,274,489	V466I	probably benign	Het
Gm11639	C	T	11: 104,843,208	R2027*	probably null	Het
Gm20671	A	T	5: 32,820,647	D1794E	probably damaging	Het
Gpatch2	G	T	1: 187,225,514	R22L	probably damaging	Het
Gtf2h1	A	G	7: 46,816,456	T450A	probably benign	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Krit1	T	G	5: 3,836,857	M702R	probably benign	Het
Krt34	T	C	11: 100,038,490	N298S	probably benign	Het
Lrrcc1	T	A	3: 14,547,316	N376K	possibly damaging	Het
Myo15	A	G	11: 60,478,133	E573G	probably damaging	Het
Olfr1224-ps1	T	A	2: 89,156,371	K268I	probably damaging	Het
Olfr1390	A	G	11: 49,340,867	S112G	probably benign	Het
Olfr366	A	T	2: 37,219,822	D111V	probably damaging	Het
Olfr391-ps	A	T	11: 73,799,319	L146Q	possibly damaging	Het
Olfr661	T	A	7: 104,688,171	V52E	possibly damaging	Het
Olfr736	T	A	14: 50,393,400	F215I	possibly damaging	Het
Phf20	A	T	2: 156,273,686	Q309L	possibly damaging	Het
Plcd1	G	A	9: 119,074,991	R292C	probably damaging	Het
Pold3	A	G	7: 100,088,105	V342A	possibly damaging	Het
Polr2a	A	T	11: 69,739,679		probably null	Het
Ptprcap	A	G	19: 4,156,224	E102G	probably benign	Het
Rab11fip5	T	C	6: 85,341,378	E843G	possibly damaging	Het
Rai14	T	C	15: 10,574,976	D632G	probably damaging	Het
Rnf149	A	T	1: 39,560,742	C268S	probably null	Het
Slc6a13	T	A	6: 121,334,839	F392I	probably damaging	Het
Slc7a11	C	T	3: 50,384,043		probably null	Het
Slf1	T	A	13: 77,084,462		probably null	Het
Stard9	G	A	2: 120,697,485	V1408I	probably benign	Het
Suclg1	T	C	6: 73,264,246	I183T	probably damaging	Het
Syne1	T	C	10: 5,255,475	E3497G	probably benign	Het
Tax1bp1	C	T	6: 52,729,376	R121*	probably null	Het
Tdpoz2	C	T	3: 93,652,336	V110I	probably benign	Het
Ubn2	A	G	6: 38,490,714	T788A	probably benign	Het
Unc13c	T	A	9: 73,734,447	I1255F	probably damaging	Het
Usp44	G	T	10: 93,846,513	R275I	probably damaging	Het
Uspl1	A	G	5: 149,215,034	N1015D	probably benign	Het
Wbp2nl	G	T	15: 82,299,045	W13C	possibly damaging	Het
Zc3h14	T	A	12: 98,758,590	D170E	possibly damaging	Het

Other mutations in Arfgef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00942:Arfgef2	APN	2	166885853	missense	probably damaging	1.00
IGL01323:Arfgef2	APN	2	166871495	missense	probably damaging	1.00
IGL01415:Arfgef2	APN	2	166867355	missense	probably damaging	0.98
IGL01638:Arfgef2	APN	2	166873945	missense	probably damaging	0.97
IGL02618:Arfgef2	APN	2	166853313	missense	probably damaging	1.00
IGL02899:Arfgef2	APN	2	166869051	splice site	probably benign
IGL03012:Arfgef2	APN	2	166868888	splice site	probably benign
IGL03063:Arfgef2	APN	2	166859782	splice site	probably benign
migrainous	UTSW	2	166834463	frame shift	probably null
Scotomata	UTSW	2	166851279	critical splice donor site	probably null
shimmering	UTSW	2	166826928	missense	probably benign
R0102:Arfgef2	UTSW	2	166845465	missense	probably benign	0.00
R0102:Arfgef2	UTSW	2	166845465	missense	probably benign	0.00
R0116:Arfgef2	UTSW	2	166873683	missense	probably damaging	1.00
R0128:Arfgef2	UTSW	2	166835719	missense	probably damaging	1.00
R0130:Arfgef2	UTSW	2	166835719	missense	probably damaging	1.00
R0208:Arfgef2	UTSW	2	166867422	missense	probably damaging	1.00
R0379:Arfgef2	UTSW	2	166860400	critical splice donor site	probably null
R0945:Arfgef2	UTSW	2	166826969	unclassified	probably benign
R1226:Arfgef2	UTSW	2	166827640	missense	probably damaging	1.00
R1252:Arfgef2	UTSW	2	166859957	missense	probably damaging	1.00
R1695:Arfgef2	UTSW	2	166864712	missense	probably damaging	0.98
R1696:Arfgef2	UTSW	2	166861638	missense	probably damaging	1.00
R1742:Arfgef2	UTSW	2	166866980	missense	probably damaging	1.00
R1935:Arfgef2	UTSW	2	166863603	missense	probably benign	0.28
R1936:Arfgef2	UTSW	2	166863603	missense	probably benign	0.28
R1939:Arfgef2	UTSW	2	166873628	missense	probably damaging	1.00
R2276:Arfgef2	UTSW	2	166865759	missense	probably benign	0.00
R2279:Arfgef2	UTSW	2	166865759	missense	probably benign	0.00
R2349:Arfgef2	UTSW	2	166852028	missense	probably damaging	1.00
R2359:Arfgef2	UTSW	2	166860619	missense	probably damaging	1.00
R2414:Arfgef2	UTSW	2	166845504	missense	probably benign	0.00
R2519:Arfgef2	UTSW	2	166881244	missense	probably benign	0.03
R2938:Arfgef2	UTSW	2	166894733	missense	probably damaging	1.00
R3696:Arfgef2	UTSW	2	166853300	nonsense	probably null
R4022:Arfgef2	UTSW	2	166873945	missense	probably benign	0.01
R4227:Arfgef2	UTSW	2	166867324	missense	probably damaging	1.00
R4293:Arfgef2	UTSW	2	166890291	missense	probably benign
R4455:Arfgef2	UTSW	2	166894715	missense	probably benign	0.43
R4499:Arfgef2	UTSW	2	166885814	missense	probably damaging	0.99
R4570:Arfgef2	UTSW	2	166856538	missense	probably damaging	0.99
R4888:Arfgef2	UTSW	2	166835613	missense	probably damaging	1.00
R4893:Arfgef2	UTSW	2	166866956	missense	probably benign
R5032:Arfgef2	UTSW	2	166878544	missense	probably benign
R5191:Arfgef2	UTSW	2	166876511	missense	probably damaging	1.00
R5200:Arfgef2	UTSW	2	166860684	missense	probably benign	0.00
R5318:Arfgef2	UTSW	2	166873971	missense	probably damaging	1.00
R5378:Arfgef2	UTSW	2	166873628	missense	probably damaging	1.00
R5537:Arfgef2	UTSW	2	166856593	splice site	probably null
R5866:Arfgef2	UTSW	2	166836257	missense	possibly damaging	0.88
R5878:Arfgef2	UTSW	2	166870217	missense	probably benign	0.41
R5972:Arfgef2	UTSW	2	166891836	missense	probably damaging	1.00
R6147:Arfgef2	UTSW	2	166871495	missense	probably damaging	1.00
R6293:Arfgef2	UTSW	2	166873588	missense	possibly damaging	0.92
R6323:Arfgef2	UTSW	2	166834484	missense	probably damaging	1.00
R6538:Arfgef2	UTSW	2	166893621	splice site	probably null
R6726:Arfgef2	UTSW	2	166893620	critical splice donor site	probably null
R7047:Arfgef2	UTSW	2	166851945	splice site	probably null
R7086:Arfgef2	UTSW	2	166876616	missense	probably damaging	1.00
R7108:Arfgef2	UTSW	2	166873608	missense	possibly damaging	0.80
R7155:Arfgef2	UTSW	2	166865813	missense	probably benign	0.19
R7159:Arfgef2	UTSW	2	166826928	missense	probably benign
R7482:Arfgef2	UTSW	2	166851279	critical splice donor site	probably null
R7598:Arfgef2	UTSW	2	166856524	missense	probably benign
R7869:Arfgef2	UTSW	2	166873703	missense	probably damaging	1.00
R8003:Arfgef2	UTSW	2	166853288	missense	probably damaging	1.00
R8092:Arfgef2	UTSW	2	166859834	missense	probably damaging	1.00
R8093:Arfgef2	UTSW	2	166894657	missense	probably benign	0.02
R8110:Arfgef2	UTSW	2	166878544	missense	probably benign	0.01
R8130:Arfgef2	UTSW	2	166836250	missense	possibly damaging	0.81
R8153:Arfgef2	UTSW	2	166834463	frame shift	probably null
R8156:Arfgef2	UTSW	2	166834463	frame shift	probably null
R8411:Arfgef2	UTSW	2	166873983	missense	probably benign	0.15
R8418:Arfgef2	UTSW	2	166856548	missense	probably benign	0.19
R8738:Arfgef2	UTSW	2	166866947	missense	probably benign	0.00
R8826:Arfgef2	UTSW	2	166835466	intron	probably benign
R8967:Arfgef2	UTSW	2	166835742	missense	probably damaging	1.00
R8971:Arfgef2	UTSW	2	166859301	missense	probably damaging	1.00
R8972:Arfgef2	UTSW	2	166867333	missense	possibly damaging	0.67
R9010:Arfgef2	UTSW	2	166859364	missense	probably damaging	1.00
R9077:Arfgef2	UTSW	2	166864801	missense	probably damaging	1.00
R9249:Arfgef2	UTSW	2	166891770	missense	probably damaging	1.00
R9306:Arfgef2	UTSW	2	166881268	missense	probably benign	0.02
R9394:Arfgef2	UTSW	2	166834549	missense	probably benign	0.13
R9776:Arfgef2	UTSW	2	166871527	missense	probably damaging	1.00
X0040:Arfgef2	UTSW	2	166859883	missense	probably damaging	1.00
X0063:Arfgef2	UTSW	2	166891841	missense	probably benign	0.32
Z1088:Arfgef2	UTSW	2	166893595	missense	possibly damaging	0.78
Z1176:Arfgef2	UTSW	2	166894712	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGGATACACACTCATTGGG -3'
(R):5'- CAAGTGCATGCGACACATATG -3'

Sequencing Primer
(F):5'- GGGCAATGACTTTGAACTTATGTC -3'
(R):5'- AGTGGTCCACGTCACTAGTATCAG -3'

Posted On

2018-04-27