Incidental Mutation 'R6338:Arfgef2'
ID 514307
Institutional Source Beutler Lab
Gene Symbol Arfgef2
Ensembl Gene ENSMUSG00000074582
Gene Name ADP ribosylation factor guanine nucleotide exchange factor 2
Synonyms BIG2, E230011G24Rik
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.381) question?
Stock # R6338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 166647508-166739972 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 166687490 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 238 (D238G)
Ref Sequence ENSEMBL: ENSMUSP00000131572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099078] [ENSMUST00000144847]
AlphaFold A2A5R2
Predicted Effect probably benign
Transcript: ENSMUST00000099078
AA Change: D350G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000096677
Gene: ENSMUSG00000074582
AA Change: D350G

DomainStartEndE-ValueType
Pfam:DCB 7 200 1.6e-40 PFAM
Pfam:Sec7_N 377 536 3.7e-53 PFAM
Blast:Sec7 549 598 8e-18 BLAST
low complexity region 621 633 N/A INTRINSIC
Sec7 647 834 1.55e-97 SMART
Blast:Sec7 853 888 2e-11 BLAST
Blast:Sec7 902 941 4e-15 BLAST
low complexity region 1044 1055 N/A INTRINSIC
Pfam:DUF1981 1174 1257 6e-38 PFAM
low complexity region 1719 1729 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144847
AA Change: D238G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP and is involved in Golgi transport. It contains a Sec7 domain, which may be responsible for its guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exencephaly, midline gut closure defects, periventricular and subependymal heterotopia, and impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adam30 T G 3: 98,068,857 (GRCm39) I102S probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Agrn C T 4: 156,255,042 (GRCm39) E1614K probably benign Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cd209e T A 8: 3,899,154 (GRCm39) D186V probably damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cdh4 T C 2: 179,532,605 (GRCm39) V689A probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Csmd1 T G 8: 15,982,492 (GRCm39) K2725T possibly damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fam13a A G 6: 58,930,484 (GRCm39) V476A probably damaging Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gpatch2 G T 1: 186,957,711 (GRCm39) R22L probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Lrrcc1 T A 3: 14,612,376 (GRCm39) N376K possibly damaging Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1af1 A T 2: 37,109,834 (GRCm39) D111V probably damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Plcd1 G A 9: 118,904,059 (GRCm39) R292C probably damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Ubn2 A G 6: 38,467,649 (GRCm39) T788A probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Zc3h14 T A 12: 98,724,849 (GRCm39) D170E possibly damaging Het
Other mutations in Arfgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Arfgef2 APN 2 166,727,773 (GRCm39) missense probably damaging 1.00
IGL01323:Arfgef2 APN 2 166,713,415 (GRCm39) missense probably damaging 1.00
IGL01415:Arfgef2 APN 2 166,709,275 (GRCm39) missense probably damaging 0.98
IGL01638:Arfgef2 APN 2 166,715,865 (GRCm39) missense probably damaging 0.97
IGL02618:Arfgef2 APN 2 166,695,233 (GRCm39) missense probably damaging 1.00
IGL02899:Arfgef2 APN 2 166,710,971 (GRCm39) splice site probably benign
IGL03012:Arfgef2 APN 2 166,710,808 (GRCm39) splice site probably benign
IGL03063:Arfgef2 APN 2 166,701,702 (GRCm39) splice site probably benign
migrainous UTSW 2 166,676,383 (GRCm39) frame shift probably null
Scotomata UTSW 2 166,693,199 (GRCm39) critical splice donor site probably null
shimmering UTSW 2 166,668,848 (GRCm39) missense probably benign
R0102:Arfgef2 UTSW 2 166,687,385 (GRCm39) missense probably benign 0.00
R0102:Arfgef2 UTSW 2 166,687,385 (GRCm39) missense probably benign 0.00
R0116:Arfgef2 UTSW 2 166,715,603 (GRCm39) missense probably damaging 1.00
R0128:Arfgef2 UTSW 2 166,677,639 (GRCm39) missense probably damaging 1.00
R0130:Arfgef2 UTSW 2 166,677,639 (GRCm39) missense probably damaging 1.00
R0208:Arfgef2 UTSW 2 166,709,342 (GRCm39) missense probably damaging 1.00
R0379:Arfgef2 UTSW 2 166,702,320 (GRCm39) critical splice donor site probably null
R0945:Arfgef2 UTSW 2 166,668,889 (GRCm39) unclassified probably benign
R1226:Arfgef2 UTSW 2 166,669,560 (GRCm39) missense probably damaging 1.00
R1252:Arfgef2 UTSW 2 166,701,877 (GRCm39) missense probably damaging 1.00
R1695:Arfgef2 UTSW 2 166,706,632 (GRCm39) missense probably damaging 0.98
R1696:Arfgef2 UTSW 2 166,703,558 (GRCm39) missense probably damaging 1.00
R1742:Arfgef2 UTSW 2 166,708,900 (GRCm39) missense probably damaging 1.00
R1935:Arfgef2 UTSW 2 166,705,523 (GRCm39) missense probably benign 0.28
R1936:Arfgef2 UTSW 2 166,705,523 (GRCm39) missense probably benign 0.28
R1939:Arfgef2 UTSW 2 166,715,548 (GRCm39) missense probably damaging 1.00
R2276:Arfgef2 UTSW 2 166,707,679 (GRCm39) missense probably benign 0.00
R2279:Arfgef2 UTSW 2 166,707,679 (GRCm39) missense probably benign 0.00
R2349:Arfgef2 UTSW 2 166,693,948 (GRCm39) missense probably damaging 1.00
R2359:Arfgef2 UTSW 2 166,702,539 (GRCm39) missense probably damaging 1.00
R2414:Arfgef2 UTSW 2 166,687,424 (GRCm39) missense probably benign 0.00
R2519:Arfgef2 UTSW 2 166,723,164 (GRCm39) missense probably benign 0.03
R2938:Arfgef2 UTSW 2 166,736,653 (GRCm39) missense probably damaging 1.00
R3696:Arfgef2 UTSW 2 166,695,220 (GRCm39) nonsense probably null
R4022:Arfgef2 UTSW 2 166,715,865 (GRCm39) missense probably benign 0.01
R4227:Arfgef2 UTSW 2 166,709,244 (GRCm39) missense probably damaging 1.00
R4293:Arfgef2 UTSW 2 166,732,211 (GRCm39) missense probably benign
R4455:Arfgef2 UTSW 2 166,736,635 (GRCm39) missense probably benign 0.43
R4499:Arfgef2 UTSW 2 166,727,734 (GRCm39) missense probably damaging 0.99
R4570:Arfgef2 UTSW 2 166,698,458 (GRCm39) missense probably damaging 0.99
R4888:Arfgef2 UTSW 2 166,677,533 (GRCm39) missense probably damaging 1.00
R4893:Arfgef2 UTSW 2 166,708,876 (GRCm39) missense probably benign
R5032:Arfgef2 UTSW 2 166,720,464 (GRCm39) missense probably benign
R5191:Arfgef2 UTSW 2 166,718,431 (GRCm39) missense probably damaging 1.00
R5200:Arfgef2 UTSW 2 166,702,604 (GRCm39) missense probably benign 0.00
R5318:Arfgef2 UTSW 2 166,715,891 (GRCm39) missense probably damaging 1.00
R5378:Arfgef2 UTSW 2 166,715,548 (GRCm39) missense probably damaging 1.00
R5537:Arfgef2 UTSW 2 166,698,513 (GRCm39) splice site probably null
R5866:Arfgef2 UTSW 2 166,678,177 (GRCm39) missense possibly damaging 0.88
R5878:Arfgef2 UTSW 2 166,712,137 (GRCm39) missense probably benign 0.41
R5972:Arfgef2 UTSW 2 166,733,756 (GRCm39) missense probably damaging 1.00
R6147:Arfgef2 UTSW 2 166,713,415 (GRCm39) missense probably damaging 1.00
R6293:Arfgef2 UTSW 2 166,715,508 (GRCm39) missense possibly damaging 0.92
R6323:Arfgef2 UTSW 2 166,676,404 (GRCm39) missense probably damaging 1.00
R6538:Arfgef2 UTSW 2 166,735,541 (GRCm39) splice site probably null
R6726:Arfgef2 UTSW 2 166,735,540 (GRCm39) critical splice donor site probably null
R7047:Arfgef2 UTSW 2 166,693,865 (GRCm39) splice site probably null
R7086:Arfgef2 UTSW 2 166,718,536 (GRCm39) missense probably damaging 1.00
R7108:Arfgef2 UTSW 2 166,715,528 (GRCm39) missense possibly damaging 0.80
R7155:Arfgef2 UTSW 2 166,707,733 (GRCm39) missense probably benign 0.19
R7159:Arfgef2 UTSW 2 166,668,848 (GRCm39) missense probably benign
R7482:Arfgef2 UTSW 2 166,693,199 (GRCm39) critical splice donor site probably null
R7598:Arfgef2 UTSW 2 166,698,444 (GRCm39) missense probably benign
R7869:Arfgef2 UTSW 2 166,715,623 (GRCm39) missense probably damaging 1.00
R8003:Arfgef2 UTSW 2 166,695,208 (GRCm39) missense probably damaging 1.00
R8092:Arfgef2 UTSW 2 166,701,754 (GRCm39) missense probably damaging 1.00
R8093:Arfgef2 UTSW 2 166,736,577 (GRCm39) missense probably benign 0.02
R8110:Arfgef2 UTSW 2 166,720,464 (GRCm39) missense probably benign 0.01
R8130:Arfgef2 UTSW 2 166,678,170 (GRCm39) missense possibly damaging 0.81
R8153:Arfgef2 UTSW 2 166,676,383 (GRCm39) frame shift probably null
R8156:Arfgef2 UTSW 2 166,676,383 (GRCm39) frame shift probably null
R8411:Arfgef2 UTSW 2 166,715,903 (GRCm39) missense probably benign 0.15
R8418:Arfgef2 UTSW 2 166,698,468 (GRCm39) missense probably benign 0.19
R8738:Arfgef2 UTSW 2 166,708,867 (GRCm39) missense probably benign 0.00
R8826:Arfgef2 UTSW 2 166,677,386 (GRCm39) intron probably benign
R8967:Arfgef2 UTSW 2 166,677,662 (GRCm39) missense probably damaging 1.00
R8971:Arfgef2 UTSW 2 166,701,221 (GRCm39) missense probably damaging 1.00
R8972:Arfgef2 UTSW 2 166,709,253 (GRCm39) missense possibly damaging 0.67
R9010:Arfgef2 UTSW 2 166,701,284 (GRCm39) missense probably damaging 1.00
R9077:Arfgef2 UTSW 2 166,706,721 (GRCm39) missense probably damaging 1.00
R9249:Arfgef2 UTSW 2 166,733,690 (GRCm39) missense probably damaging 1.00
R9306:Arfgef2 UTSW 2 166,723,188 (GRCm39) missense probably benign 0.02
R9394:Arfgef2 UTSW 2 166,676,469 (GRCm39) missense probably benign 0.13
R9776:Arfgef2 UTSW 2 166,713,447 (GRCm39) missense probably damaging 1.00
X0040:Arfgef2 UTSW 2 166,701,803 (GRCm39) missense probably damaging 1.00
X0063:Arfgef2 UTSW 2 166,733,761 (GRCm39) missense probably benign 0.32
Z1088:Arfgef2 UTSW 2 166,735,515 (GRCm39) missense possibly damaging 0.78
Z1176:Arfgef2 UTSW 2 166,736,632 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGATACACACTCATTGGG -3'
(R):5'- CAAGTGCATGCGACACATATG -3'

Sequencing Primer
(F):5'- GGGCAATGACTTTGAACTTATGTC -3'
(R):5'- AGTGGTCCACGTCACTAGTATCAG -3'
Posted On 2018-04-27