Incidental Mutation 'R6338:Cdh4'
ID 514308
Institutional Source Beutler Lab
Gene Symbol Cdh4
Ensembl Gene ENSMUSG00000000305
Gene Name cadherin 4
Synonyms R-Cadh, R-cadherin, Rcad
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 179084228-179541166 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 179532605 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 689 (V689A)
Ref Sequence ENSEMBL: ENSMUSP00000000314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000314] [ENSMUST00000098996]
AlphaFold P39038
Predicted Effect probably damaging
Transcript: ENSMUST00000000314
AA Change: V689A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305
AA Change: V689A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Cadherin_pro 30 121 1.18e-30 SMART
CA 187 272 2.31e-15 SMART
CA 296 387 4.33e-29 SMART
CA 410 503 2.21e-12 SMART
CA 526 610 7.16e-21 SMART
CA 630 715 3.78e-2 SMART
transmembrane domain 730 752 N/A INTRINSIC
Pfam:Cadherin_C 760 909 2.5e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129659
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adam30 T G 3: 98,068,857 (GRCm39) I102S probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Agrn C T 4: 156,255,042 (GRCm39) E1614K probably benign Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arfgef2 A G 2: 166,687,490 (GRCm39) D238G probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cd209e T A 8: 3,899,154 (GRCm39) D186V probably damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Csmd1 T G 8: 15,982,492 (GRCm39) K2725T possibly damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fam13a A G 6: 58,930,484 (GRCm39) V476A probably damaging Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gpatch2 G T 1: 186,957,711 (GRCm39) R22L probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Lrrcc1 T A 3: 14,612,376 (GRCm39) N376K possibly damaging Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1af1 A T 2: 37,109,834 (GRCm39) D111V probably damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Plcd1 G A 9: 118,904,059 (GRCm39) R292C probably damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Ubn2 A G 6: 38,467,649 (GRCm39) T788A probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Zc3h14 T A 12: 98,724,849 (GRCm39) D170E possibly damaging Het
Other mutations in Cdh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdh4 APN 2 179,515,937 (GRCm39) missense probably damaging 1.00
IGL01411:Cdh4 APN 2 179,422,196 (GRCm39) missense probably damaging 0.96
IGL01752:Cdh4 APN 2 179,532,677 (GRCm39) missense probably damaging 1.00
IGL02814:Cdh4 APN 2 179,422,267 (GRCm39) missense probably benign 0.01
R0082:Cdh4 UTSW 2 179,535,981 (GRCm39) missense possibly damaging 0.75
R0357:Cdh4 UTSW 2 179,489,133 (GRCm39) missense probably damaging 1.00
R1521:Cdh4 UTSW 2 179,439,351 (GRCm39) missense probably damaging 1.00
R1591:Cdh4 UTSW 2 179,528,657 (GRCm39) critical splice donor site probably null
R1622:Cdh4 UTSW 2 179,530,885 (GRCm39) missense possibly damaging 0.56
R1762:Cdh4 UTSW 2 179,439,273 (GRCm39) missense probably benign 0.01
R1794:Cdh4 UTSW 2 179,528,635 (GRCm39) missense probably damaging 1.00
R2275:Cdh4 UTSW 2 179,532,640 (GRCm39) missense probably damaging 1.00
R2277:Cdh4 UTSW 2 179,439,317 (GRCm39) missense possibly damaging 0.88
R3686:Cdh4 UTSW 2 179,422,160 (GRCm39) missense probably benign 0.09
R3861:Cdh4 UTSW 2 179,515,890 (GRCm39) missense probably damaging 1.00
R4078:Cdh4 UTSW 2 179,530,966 (GRCm39) missense possibly damaging 0.93
R4495:Cdh4 UTSW 2 179,422,182 (GRCm39) missense probably damaging 0.98
R4715:Cdh4 UTSW 2 179,422,260 (GRCm39) missense probably benign 0.03
R4893:Cdh4 UTSW 2 179,489,212 (GRCm39) intron probably benign
R5029:Cdh4 UTSW 2 179,523,742 (GRCm39) missense possibly damaging 0.93
R5363:Cdh4 UTSW 2 179,528,556 (GRCm39) missense probably benign
R5542:Cdh4 UTSW 2 179,502,019 (GRCm39) missense probably damaging 0.98
R5773:Cdh4 UTSW 2 179,527,789 (GRCm39) missense probably damaging 1.00
R5791:Cdh4 UTSW 2 179,537,560 (GRCm39) missense probably damaging 1.00
R6262:Cdh4 UTSW 2 179,439,419 (GRCm39) missense probably damaging 1.00
R6589:Cdh4 UTSW 2 179,523,789 (GRCm39) critical splice donor site probably null
R6607:Cdh4 UTSW 2 179,515,889 (GRCm39) missense probably benign 0.00
R6653:Cdh4 UTSW 2 179,422,221 (GRCm39) missense probably benign 0.34
R6711:Cdh4 UTSW 2 179,532,724 (GRCm39) missense probably damaging 1.00
R6744:Cdh4 UTSW 2 179,489,180 (GRCm39) missense possibly damaging 0.68
R6824:Cdh4 UTSW 2 179,439,351 (GRCm39) missense probably damaging 1.00
R6901:Cdh4 UTSW 2 179,501,987 (GRCm39) missense probably benign 0.19
R6981:Cdh4 UTSW 2 179,439,297 (GRCm39) missense probably benign 0.28
R7285:Cdh4 UTSW 2 179,439,258 (GRCm39) missense probably benign 0.00
R7514:Cdh4 UTSW 2 179,532,636 (GRCm39) missense possibly damaging 0.91
R7541:Cdh4 UTSW 2 179,086,603 (GRCm39) splice site probably null
R7560:Cdh4 UTSW 2 179,532,695 (GRCm39) missense probably benign 0.25
R8146:Cdh4 UTSW 2 179,515,871 (GRCm39) missense possibly damaging 0.91
R8833:Cdh4 UTSW 2 179,535,828 (GRCm39) missense possibly damaging 0.61
R9075:Cdh4 UTSW 2 179,501,940 (GRCm39) missense probably damaging 0.97
R9203:Cdh4 UTSW 2 179,422,196 (GRCm39) missense probably damaging 0.96
Z1177:Cdh4 UTSW 2 179,422,119 (GRCm39) missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ATATGCTGTACATACATGCGTGC -3'
(R):5'- ACTTACTTAGCAGGATCACGATGC -3'

Sequencing Primer
(F):5'- ACATACATGCGTGCGTGTG -3'
(R):5'- TACTTAGCAGGATCACGATGCAGATG -3'
Posted On 2018-04-27