Mutagenetix > Incidental Mutations

Incidental Mutation 'R6338:Lrrcc1'

514309

Institutional Source

Beutler Lab

Gene Symbol

Lrrcc1

Ensembl Gene

ENSMUSG00000027550

Gene Name

leucine rich repeat and coiled-coil domain containing 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6338 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

14533788-14572658 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14547316 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 376 (N376K)

Ref Sequence

ENSEMBL: ENSMUSP00000088875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091325] [ENSMUST00000108370] [ENSMUST00000163660] [ENSMUST00000165436] [ENSMUST00000167858] [ENSMUST00000169079]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091325
AA Change: N376K

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000088875
Gene: ENSMUSG00000027550
AA Change: N376K

Domain	Start	End	E-Value	Type
Pfam:LRR_8	60	116	1.1e-9	PFAM
Pfam:LRR_4	82	126	4.8e-8	PFAM
Blast:LRR	130	151	1e-5	BLAST
coiled coil region	412	626	N/A	INTRINSIC
coiled coil region	675	718	N/A	INTRINSIC
coiled coil region	757	1010	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108370
AA Change: N392K

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000104007
Gene: ENSMUSG00000027550
AA Change: N392K

Domain	Start	End	E-Value	Type
Pfam:LRR_8	60	116	1.1e-9	PFAM
Pfam:LRR_4	82	124	4.5e-8	PFAM
Blast:LRR	130	151	1e-5	BLAST
low complexity region	289	301	N/A	INTRINSIC
coiled coil region	428	642	N/A	INTRINSIC
coiled coil region	691	734	N/A	INTRINSIC
coiled coil region	773	953	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163660
AA Change: N270K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000128733
Gene: ENSMUSG00000027550
AA Change: N270K

Domain	Start	End	E-Value	Type
Blast:LRR	8	29	7e-6	BLAST
SCOP:d1dcea3	9	71	9e-4	SMART
low complexity region	167	179	N/A	INTRINSIC
coiled coil region	306	520	N/A	INTRINSIC
coiled coil region	569	612	N/A	INTRINSIC
coiled coil region	651	716	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165436

SMART Domains

Protein: ENSMUSP00000129430
Gene: ENSMUSG00000027550

Domain	Start	End	E-Value	Type
Pfam:LRR_9	32	154	4e-10	PFAM
Pfam:LRR_6	60	83	1.4e-4	PFAM
Pfam:LRR_4	60	103	6.2e-11	PFAM
Pfam:LRR_8	60	116	8.1e-11	PFAM
Pfam:LRR_1	61	81	3.3e-4	PFAM
Pfam:LRR_6	78	105	3.4e-3	PFAM
Pfam:LRR_4	82	125	4.9e-9	PFAM
Pfam:LRR_6	103	125	5.1e-4	PFAM
Pfam:LRR_4	104	149	1.2e-8	PFAM
Pfam:LRR_1	105	128	3.8e-3	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000167858

SMART Domains

Protein: ENSMUSP00000129368
Gene: ENSMUSG00000027550

Domain	Start	End	E-Value	Type
coiled coil region	7	221	N/A	INTRINSIC
coiled coil region	270	313	N/A	INTRINSIC
low complexity region	450	472	N/A	INTRINSIC
SCOP:d1ek8a_	494	550	7e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169079
AA Change: N392K

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000126560
Gene: ENSMUSG00000027550
AA Change: N392K

Domain	Start	End	E-Value	Type
Pfam:LRR_4	60	102	4.3e-9	PFAM
internal_repeat_1	109	145	1.05e-6	PROSPERO
low complexity region	289	301	N/A	INTRINSIC
coiled coil region	428	642	N/A	INTRINSIC
coiled coil region	691	734	N/A	INTRINSIC
coiled coil region	773	1026	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169799

SMART Domains

Protein: ENSMUSP00000126592
Gene: ENSMUSG00000027550

Domain	Start	End	E-Value	Type
coiled coil region	1	131	N/A	INTRINSIC
coiled coil region	200	228	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171620

SMART Domains

Protein: ENSMUSP00000128252
Gene: ENSMUSG00000027550

Domain	Start	End	E-Value	Type
coiled coil region	30	91	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer3	T	C	7: 98,257,715	Y128C	probably damaging	Het
Adam30	T	G	3: 98,161,541	I102S	probably damaging	Het
Adcy8	A	T	15: 64,920,617	D163E	possibly damaging	Het
Agrn	C	T	4: 156,170,585	E1614K	probably benign	Het
Aldh16a1	A	T	7: 45,141,961	W107R	probably damaging	Het
Arfgef2	A	G	2: 166,845,570	D238G	probably damaging	Het
Arhgap11a	T	C	2: 113,833,725	S738G	probably benign	Het
Arid5b	C	A	10: 68,098,561	G504*	probably null	Het
Carmil3	T	C	14: 55,499,849	V763A	possibly damaging	Het
Cd209e	T	A	8: 3,849,154	D186V	probably damaging	Het
Cdh23	T	C	10: 60,413,151	D882G	probably damaging	Het
Cdh4	T	C	2: 179,890,812	V689A	probably damaging	Het
Cntn6	T	A	6: 104,726,139	V174E	probably damaging	Het
Col7a1	C	T	9: 108,956,633	T390M	unknown	Het
Crybg1	T	C	10: 43,992,509	D1017G	probably damaging	Het
Csmd1	T	G	8: 15,932,492	K2725T	possibly damaging	Het
Dnaaf2	T	C	12: 69,198,122	E55G	probably damaging	Het
Fam13a	A	G	6: 58,953,499	V476A	probably damaging	Het
Fem1b	A	T	9: 62,797,011	D322E	probably benign	Het
Frmpd1	G	A	4: 45,274,489	V466I	probably benign	Het
Gm11639	C	T	11: 104,843,208	R2027*	probably null	Het
Gm20671	A	T	5: 32,820,647	D1794E	probably damaging	Het
Gpatch2	G	T	1: 187,225,514	R22L	probably damaging	Het
Gtf2h1	A	G	7: 46,816,456	T450A	probably benign	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Krit1	T	G	5: 3,836,857	M702R	probably benign	Het
Krt34	T	C	11: 100,038,490	N298S	probably benign	Het
Myo15	A	G	11: 60,478,133	E573G	probably damaging	Het
Olfr1224-ps1	T	A	2: 89,156,371	K268I	probably damaging	Het
Olfr1390	A	G	11: 49,340,867	S112G	probably benign	Het
Olfr366	A	T	2: 37,219,822	D111V	probably damaging	Het
Olfr391-ps	A	T	11: 73,799,319	L146Q	possibly damaging	Het
Olfr661	T	A	7: 104,688,171	V52E	possibly damaging	Het
Olfr736	T	A	14: 50,393,400	F215I	possibly damaging	Het
Phf20	A	T	2: 156,273,686	Q309L	possibly damaging	Het
Plcd1	G	A	9: 119,074,991	R292C	probably damaging	Het
Pold3	A	G	7: 100,088,105	V342A	possibly damaging	Het
Polr2a	A	T	11: 69,739,679		probably null	Het
Ptprcap	A	G	19: 4,156,224	E102G	probably benign	Het
Rab11fip5	T	C	6: 85,341,378	E843G	possibly damaging	Het
Rai14	T	C	15: 10,574,976	D632G	probably damaging	Het
Rnf149	A	T	1: 39,560,742	C268S	probably null	Het
Slc6a13	T	A	6: 121,334,839	F392I	probably damaging	Het
Slc7a11	C	T	3: 50,384,043		probably null	Het
Slf1	T	A	13: 77,084,462		probably null	Het
Stard9	G	A	2: 120,697,485	V1408I	probably benign	Het
Suclg1	T	C	6: 73,264,246	I183T	probably damaging	Het
Syne1	T	C	10: 5,255,475	E3497G	probably benign	Het
Tax1bp1	C	T	6: 52,729,376	R121*	probably null	Het
Tdpoz2	C	T	3: 93,652,336	V110I	probably benign	Het
Ubn2	A	G	6: 38,490,714	T788A	probably benign	Het
Unc13c	T	A	9: 73,734,447	I1255F	probably damaging	Het
Usp44	G	T	10: 93,846,513	R275I	probably damaging	Het
Uspl1	A	G	5: 149,215,034	N1015D	probably benign	Het
Wbp2nl	G	T	15: 82,299,045	W13C	possibly damaging	Het
Zc3h14	T	A	12: 98,758,590	D170E	possibly damaging	Het

Other mutations in Lrrcc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Lrrcc1	APN	3	14536128	missense	possibly damaging	0.91
IGL01325:Lrrcc1	APN	3	14536541	critical splice donor site	probably null
IGL01681:Lrrcc1	APN	3	14548226	missense	probably benign	0.35
IGL01767:Lrrcc1	APN	3	14547272	missense	probably damaging	0.97
IGL01868:Lrrcc1	APN	3	14554357	nonsense	probably null
IGL03123:Lrrcc1	APN	3	14536084	missense	probably damaging	0.97
PIT1430001:Lrrcc1	UTSW	3	14545596	missense	probably damaging	0.99
R0295:Lrrcc1	UTSW	3	14565849	missense	probably benign	0.05
R0427:Lrrcc1	UTSW	3	14558356	missense	probably damaging	1.00
R0433:Lrrcc1	UTSW	3	14559374	missense	probably damaging	1.00
R0534:Lrrcc1	UTSW	3	14557273	missense	probably damaging	1.00
R0631:Lrrcc1	UTSW	3	14540119	splice site	probably benign
R0635:Lrrcc1	UTSW	3	14559228	missense	probably benign	0.11
R1355:Lrrcc1	UTSW	3	14548114	missense	probably benign	0.07
R1370:Lrrcc1	UTSW	3	14548114	missense	probably benign	0.07
R1727:Lrrcc1	UTSW	3	14537363	missense	probably damaging	0.99
R1822:Lrrcc1	UTSW	3	14559225	unclassified	probably benign
R1946:Lrrcc1	UTSW	3	14550393	missense	probably benign	0.02
R2254:Lrrcc1	UTSW	3	14547255	missense	probably damaging	1.00
R2362:Lrrcc1	UTSW	3	14563024	missense	probably damaging	1.00
R2392:Lrrcc1	UTSW	3	14536520	missense	probably damaging	1.00
R4105:Lrrcc1	UTSW	3	14550328	missense	probably benign	0.21
R4464:Lrrcc1	UTSW	3	14557318	missense	probably damaging	1.00
R4484:Lrrcc1	UTSW	3	14551443	missense	probably damaging	1.00
R4543:Lrrcc1	UTSW	3	14539791	missense	probably damaging	0.98
R4718:Lrrcc1	UTSW	3	14536032	missense	probably damaging	1.00
R4734:Lrrcc1	UTSW	3	14562285	missense	probably damaging	1.00
R4799:Lrrcc1	UTSW	3	14536096	nonsense	probably null
R4841:Lrrcc1	UTSW	3	14562511	missense	probably benign	0.04
R4842:Lrrcc1	UTSW	3	14562511	missense	probably benign	0.04
R5900:Lrrcc1	UTSW	3	14562126	missense	possibly damaging	0.69
R7001:Lrrcc1	UTSW	3	14540095	missense	probably damaging	0.99
R7036:Lrrcc1	UTSW	3	14563009	missense	possibly damaging	0.80
R7342:Lrrcc1	UTSW	3	14554371	missense	probably benign
R8038:Lrrcc1	UTSW	3	14565830	missense	possibly damaging	0.77
R8497:Lrrcc1	UTSW	3	14539984	missense	possibly damaging	0.80
R8509:Lrrcc1	UTSW	3	14536507	missense	probably damaging	1.00
R8679:Lrrcc1	UTSW	3	14536024	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTGAATCAGCAAATCACATCCCTT -3'
(R):5'- GTACACAAAATCTGGGAACTGG -3'

Sequencing Primer
(F):5'- ATGTCCAGGTGCCTGCTAATGAC -3'
(R):5'- TACACAAAATCTGGGAACTGGGAAGG -3'

Posted On

2018-04-27