Incidental Mutation 'R6338:Lrrcc1'
ID 514309
Institutional Source Beutler Lab
Gene Symbol Lrrcc1
Ensembl Gene ENSMUSG00000027550
Gene Name leucine rich repeat and coiled-coil domain containing 1
Synonyms 1200008A14Rik, 4932441F23Rik
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 14598848-14637718 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14612376 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 376 (N376K)
Ref Sequence ENSEMBL: ENSMUSP00000088875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091325] [ENSMUST00000108370] [ENSMUST00000163660] [ENSMUST00000165436] [ENSMUST00000167858] [ENSMUST00000169079]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000091325
AA Change: N376K

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088875
Gene: ENSMUSG00000027550
AA Change: N376K

DomainStartEndE-ValueType
Pfam:LRR_8 60 116 1.1e-9 PFAM
Pfam:LRR_4 82 126 4.8e-8 PFAM
Blast:LRR 130 151 1e-5 BLAST
coiled coil region 412 626 N/A INTRINSIC
coiled coil region 675 718 N/A INTRINSIC
coiled coil region 757 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108370
AA Change: N392K

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104007
Gene: ENSMUSG00000027550
AA Change: N392K

DomainStartEndE-ValueType
Pfam:LRR_8 60 116 1.1e-9 PFAM
Pfam:LRR_4 82 124 4.5e-8 PFAM
Blast:LRR 130 151 1e-5 BLAST
low complexity region 289 301 N/A INTRINSIC
coiled coil region 428 642 N/A INTRINSIC
coiled coil region 691 734 N/A INTRINSIC
coiled coil region 773 953 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163660
AA Change: N270K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000128733
Gene: ENSMUSG00000027550
AA Change: N270K

DomainStartEndE-ValueType
Blast:LRR 8 29 7e-6 BLAST
SCOP:d1dcea3 9 71 9e-4 SMART
low complexity region 167 179 N/A INTRINSIC
coiled coil region 306 520 N/A INTRINSIC
coiled coil region 569 612 N/A INTRINSIC
coiled coil region 651 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165436
SMART Domains Protein: ENSMUSP00000129430
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
Pfam:LRR_9 32 154 4e-10 PFAM
Pfam:LRR_6 60 83 1.4e-4 PFAM
Pfam:LRR_4 60 103 6.2e-11 PFAM
Pfam:LRR_8 60 116 8.1e-11 PFAM
Pfam:LRR_1 61 81 3.3e-4 PFAM
Pfam:LRR_6 78 105 3.4e-3 PFAM
Pfam:LRR_4 82 125 4.9e-9 PFAM
Pfam:LRR_6 103 125 5.1e-4 PFAM
Pfam:LRR_4 104 149 1.2e-8 PFAM
Pfam:LRR_1 105 128 3.8e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167858
SMART Domains Protein: ENSMUSP00000129368
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
coiled coil region 7 221 N/A INTRINSIC
coiled coil region 270 313 N/A INTRINSIC
low complexity region 450 472 N/A INTRINSIC
SCOP:d1ek8a_ 494 550 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169079
AA Change: N392K

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126560
Gene: ENSMUSG00000027550
AA Change: N392K

DomainStartEndE-ValueType
Pfam:LRR_4 60 102 4.3e-9 PFAM
internal_repeat_1 109 145 1.05e-6 PROSPERO
low complexity region 289 301 N/A INTRINSIC
coiled coil region 428 642 N/A INTRINSIC
coiled coil region 691 734 N/A INTRINSIC
coiled coil region 773 1026 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171620
SMART Domains Protein: ENSMUSP00000128252
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
coiled coil region 30 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169799
SMART Domains Protein: ENSMUSP00000126592
Gene: ENSMUSG00000027550

DomainStartEndE-ValueType
coiled coil region 1 131 N/A INTRINSIC
coiled coil region 200 228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adam30 T G 3: 98,068,857 (GRCm39) I102S probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Agrn C T 4: 156,255,042 (GRCm39) E1614K probably benign Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arfgef2 A G 2: 166,687,490 (GRCm39) D238G probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cd209e T A 8: 3,899,154 (GRCm39) D186V probably damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cdh4 T C 2: 179,532,605 (GRCm39) V689A probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Csmd1 T G 8: 15,982,492 (GRCm39) K2725T possibly damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fam13a A G 6: 58,930,484 (GRCm39) V476A probably damaging Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gpatch2 G T 1: 186,957,711 (GRCm39) R22L probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1af1 A T 2: 37,109,834 (GRCm39) D111V probably damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Plcd1 G A 9: 118,904,059 (GRCm39) R292C probably damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Ubn2 A G 6: 38,467,649 (GRCm39) T788A probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Zc3h14 T A 12: 98,724,849 (GRCm39) D170E possibly damaging Het
Other mutations in Lrrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Lrrcc1 APN 3 14,601,188 (GRCm39) missense possibly damaging 0.91
IGL01325:Lrrcc1 APN 3 14,601,601 (GRCm39) critical splice donor site probably null
IGL01681:Lrrcc1 APN 3 14,613,286 (GRCm39) missense probably benign 0.35
IGL01767:Lrrcc1 APN 3 14,612,332 (GRCm39) missense probably damaging 0.97
IGL01868:Lrrcc1 APN 3 14,619,417 (GRCm39) nonsense probably null
IGL03123:Lrrcc1 APN 3 14,601,144 (GRCm39) missense probably damaging 0.97
PIT1430001:Lrrcc1 UTSW 3 14,610,656 (GRCm39) missense probably damaging 0.99
R0295:Lrrcc1 UTSW 3 14,630,909 (GRCm39) missense probably benign 0.05
R0427:Lrrcc1 UTSW 3 14,623,416 (GRCm39) missense probably damaging 1.00
R0433:Lrrcc1 UTSW 3 14,624,434 (GRCm39) missense probably damaging 1.00
R0534:Lrrcc1 UTSW 3 14,622,333 (GRCm39) missense probably damaging 1.00
R0631:Lrrcc1 UTSW 3 14,605,179 (GRCm39) splice site probably benign
R0635:Lrrcc1 UTSW 3 14,624,288 (GRCm39) missense probably benign 0.11
R1355:Lrrcc1 UTSW 3 14,613,174 (GRCm39) missense probably benign 0.07
R1370:Lrrcc1 UTSW 3 14,613,174 (GRCm39) missense probably benign 0.07
R1727:Lrrcc1 UTSW 3 14,602,423 (GRCm39) missense probably damaging 0.99
R1822:Lrrcc1 UTSW 3 14,624,285 (GRCm39) unclassified probably benign
R1946:Lrrcc1 UTSW 3 14,615,453 (GRCm39) missense probably benign 0.02
R2254:Lrrcc1 UTSW 3 14,612,315 (GRCm39) missense probably damaging 1.00
R2362:Lrrcc1 UTSW 3 14,628,084 (GRCm39) missense probably damaging 1.00
R2392:Lrrcc1 UTSW 3 14,601,580 (GRCm39) missense probably damaging 1.00
R4105:Lrrcc1 UTSW 3 14,615,388 (GRCm39) missense probably benign 0.21
R4464:Lrrcc1 UTSW 3 14,622,378 (GRCm39) missense probably damaging 1.00
R4484:Lrrcc1 UTSW 3 14,616,503 (GRCm39) missense probably damaging 1.00
R4543:Lrrcc1 UTSW 3 14,604,851 (GRCm39) missense probably damaging 0.98
R4718:Lrrcc1 UTSW 3 14,601,092 (GRCm39) missense probably damaging 1.00
R4734:Lrrcc1 UTSW 3 14,627,345 (GRCm39) missense probably damaging 1.00
R4799:Lrrcc1 UTSW 3 14,601,156 (GRCm39) nonsense probably null
R4841:Lrrcc1 UTSW 3 14,627,571 (GRCm39) missense probably benign 0.04
R4842:Lrrcc1 UTSW 3 14,627,571 (GRCm39) missense probably benign 0.04
R5900:Lrrcc1 UTSW 3 14,627,186 (GRCm39) missense possibly damaging 0.69
R7001:Lrrcc1 UTSW 3 14,605,155 (GRCm39) missense probably damaging 0.99
R7036:Lrrcc1 UTSW 3 14,628,069 (GRCm39) missense possibly damaging 0.80
R7342:Lrrcc1 UTSW 3 14,619,431 (GRCm39) missense probably benign
R8038:Lrrcc1 UTSW 3 14,630,890 (GRCm39) missense possibly damaging 0.77
R8497:Lrrcc1 UTSW 3 14,605,044 (GRCm39) missense possibly damaging 0.80
R8509:Lrrcc1 UTSW 3 14,601,567 (GRCm39) missense probably damaging 1.00
R8679:Lrrcc1 UTSW 3 14,601,084 (GRCm39) missense probably benign 0.00
R8966:Lrrcc1 UTSW 3 14,602,359 (GRCm39) missense probably damaging 1.00
R9120:Lrrcc1 UTSW 3 14,615,489 (GRCm39) nonsense probably null
R9251:Lrrcc1 UTSW 3 14,623,454 (GRCm39) missense probably damaging 1.00
R9512:Lrrcc1 UTSW 3 14,613,301 (GRCm39) missense possibly damaging 0.95
R9572:Lrrcc1 UTSW 3 14,601,148 (GRCm39) nonsense probably null
R9788:Lrrcc1 UTSW 3 14,602,286 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAATCAGCAAATCACATCCCTT -3'
(R):5'- GTACACAAAATCTGGGAACTGG -3'

Sequencing Primer
(F):5'- ATGTCCAGGTGCCTGCTAATGAC -3'
(R):5'- TACACAAAATCTGGGAACTGGGAAGG -3'
Posted On 2018-04-27