Incidental Mutation 'R6338:Adam30'
ID 514312
Institutional Source Beutler Lab
Gene Symbol Adam30
Ensembl Gene ENSMUSG00000043468
Gene Name a disintegrin and metallopeptidase domain 30
Synonyms 4933424D07Rik
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R6338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 98067950-98071485 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 98068857 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 102 (I102S)
Ref Sequence ENSEMBL: ENSMUSP00000142590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050342] [ENSMUST00000198363]
AlphaFold Q811Q3
Predicted Effect probably damaging
Transcript: ENSMUST00000050342
AA Change: I230S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060505
Gene: ENSMUSG00000043468
AA Change: I230S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 36 159 5.7e-20 PFAM
low complexity region 176 187 N/A INTRINSIC
Pfam:Reprolysin 202 393 1.1e-31 PFAM
DISIN 407 482 1.6e-32 SMART
ACR 483 625 1.84e-52 SMART
transmembrane domain 690 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198363
AA Change: I102S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142590
Gene: ENSMUSG00000043468
AA Change: I102S

DomainStartEndE-ValueType
low complexity region 48 59 N/A INTRINSIC
Pfam:Reprolysin_5 72 259 2.6e-6 PFAM
Pfam:Reprolysin 74 265 2.1e-29 PFAM
Pfam:Reprolysin_3 101 220 1.1e-4 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This gene is testis-specific and contains a polymorphic region, resulting in isoforms with varying numbers of C-terminal repeats. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Agrn C T 4: 156,255,042 (GRCm39) E1614K probably benign Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arfgef2 A G 2: 166,687,490 (GRCm39) D238G probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cd209e T A 8: 3,899,154 (GRCm39) D186V probably damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cdh4 T C 2: 179,532,605 (GRCm39) V689A probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Csmd1 T G 8: 15,982,492 (GRCm39) K2725T possibly damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fam13a A G 6: 58,930,484 (GRCm39) V476A probably damaging Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gpatch2 G T 1: 186,957,711 (GRCm39) R22L probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Lrrcc1 T A 3: 14,612,376 (GRCm39) N376K possibly damaging Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1af1 A T 2: 37,109,834 (GRCm39) D111V probably damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Plcd1 G A 9: 118,904,059 (GRCm39) R292C probably damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Ubn2 A G 6: 38,467,649 (GRCm39) T788A probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Zc3h14 T A 12: 98,724,849 (GRCm39) D170E possibly damaging Het
Other mutations in Adam30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Adam30 APN 3 98,069,486 (GRCm39) missense probably benign 0.01
IGL01630:Adam30 APN 3 98,069,171 (GRCm39) missense possibly damaging 0.83
IGL01825:Adam30 APN 3 98,069,217 (GRCm39) missense probably damaging 0.96
IGL02033:Adam30 APN 3 98,068,787 (GRCm39) missense probably benign 0.13
IGL03157:Adam30 APN 3 98,069,612 (GRCm39) missense possibly damaging 0.85
IGL03330:Adam30 APN 3 98,069,772 (GRCm39) missense probably damaging 1.00
R0512:Adam30 UTSW 3 98,069,441 (GRCm39) missense probably damaging 1.00
R1082:Adam30 UTSW 3 98,069,606 (GRCm39) missense probably benign 0.30
R1173:Adam30 UTSW 3 98,070,222 (GRCm39) missense probably benign 0.07
R1463:Adam30 UTSW 3 98,069,841 (GRCm39) missense probably damaging 1.00
R1771:Adam30 UTSW 3 98,068,835 (GRCm39) missense possibly damaging 0.94
R1862:Adam30 UTSW 3 98,069,429 (GRCm39) nonsense probably null
R3442:Adam30 UTSW 3 98,069,886 (GRCm39) missense probably benign 0.35
R4125:Adam30 UTSW 3 98,068,679 (GRCm39) missense probably damaging 1.00
R4714:Adam30 UTSW 3 98,070,170 (GRCm39) missense probably damaging 1.00
R4816:Adam30 UTSW 3 98,070,061 (GRCm39) missense possibly damaging 0.68
R5447:Adam30 UTSW 3 98,068,659 (GRCm39) missense probably benign 0.09
R5958:Adam30 UTSW 3 98,069,280 (GRCm39) missense probably damaging 1.00
R6175:Adam30 UTSW 3 98,070,266 (GRCm39) missense probably damaging 1.00
R6220:Adam30 UTSW 3 98,068,625 (GRCm39) missense probably damaging 0.98
R6365:Adam30 UTSW 3 98,068,350 (GRCm39) missense probably damaging 0.99
R6998:Adam30 UTSW 3 98,070,026 (GRCm39) missense probably benign 0.03
R7086:Adam30 UTSW 3 98,068,635 (GRCm39) missense probably damaging 1.00
R7290:Adam30 UTSW 3 98,070,257 (GRCm39) missense probably benign 0.00
R7340:Adam30 UTSW 3 98,069,637 (GRCm39) missense probably benign 0.14
R8181:Adam30 UTSW 3 98,070,291 (GRCm39) missense probably benign
R8725:Adam30 UTSW 3 98,070,348 (GRCm39) missense possibly damaging 0.96
R8727:Adam30 UTSW 3 98,070,348 (GRCm39) missense possibly damaging 0.96
R8913:Adam30 UTSW 3 98,068,580 (GRCm39) missense possibly damaging 0.68
R8977:Adam30 UTSW 3 98,069,378 (GRCm39) missense probably damaging 0.98
R9008:Adam30 UTSW 3 98,070,034 (GRCm39) nonsense probably null
R9126:Adam30 UTSW 3 98,068,307 (GRCm39) missense probably benign 0.00
R9181:Adam30 UTSW 3 98,070,194 (GRCm39) missense probably benign 0.05
R9274:Adam30 UTSW 3 98,069,267 (GRCm39) missense probably benign 0.06
R9338:Adam30 UTSW 3 98,070,129 (GRCm39) missense probably damaging 1.00
R9636:Adam30 UTSW 3 98,068,312 (GRCm39) missense probably benign 0.06
R9640:Adam30 UTSW 3 98,069,620 (GRCm39) missense probably damaging 1.00
R9651:Adam30 UTSW 3 98,069,936 (GRCm39) missense possibly damaging 0.92
Z1176:Adam30 UTSW 3 98,069,676 (GRCm39) missense possibly damaging 0.92
Z1177:Adam30 UTSW 3 98,068,295 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCGAACACGTGGTGTATCTC -3'
(R):5'- CCGGTGATGCATTGAGTTTC -3'

Sequencing Primer
(F):5'- CGAACACGTGGTGTATCTCGTAAC -3'
(R):5'- CTTTTGTAATGCACGAATTGACC -3'
Posted On 2018-04-27