Incidental Mutation 'R6338:Adam30'
ID514312
Institutional Source Beutler Lab
Gene Symbol Adam30
Ensembl Gene ENSMUSG00000043468
Gene Namea disintegrin and metallopeptidase domain 30
Synonyms4933424D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6338 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location98160630-98164169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 98161541 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 102 (I102S)
Ref Sequence ENSEMBL: ENSMUSP00000142590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050342] [ENSMUST00000198363]
Predicted Effect probably damaging
Transcript: ENSMUST00000050342
AA Change: I230S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060505
Gene: ENSMUSG00000043468
AA Change: I230S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 36 159 5.7e-20 PFAM
low complexity region 176 187 N/A INTRINSIC
Pfam:Reprolysin 202 393 1.1e-31 PFAM
DISIN 407 482 1.6e-32 SMART
ACR 483 625 1.84e-52 SMART
transmembrane domain 690 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198363
AA Change: I102S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142590
Gene: ENSMUSG00000043468
AA Change: I102S

DomainStartEndE-ValueType
low complexity region 48 59 N/A INTRINSIC
Pfam:Reprolysin_5 72 259 2.6e-6 PFAM
Pfam:Reprolysin 74 265 2.1e-29 PFAM
Pfam:Reprolysin_3 101 220 1.1e-4 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This gene is testis-specific and contains a polymorphic region, resulting in isoforms with varying numbers of C-terminal repeats. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Adam30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Adam30 APN 3 98162170 missense probably benign 0.01
IGL01630:Adam30 APN 3 98161855 missense possibly damaging 0.83
IGL01825:Adam30 APN 3 98161901 missense probably damaging 0.96
IGL02033:Adam30 APN 3 98161471 missense probably benign 0.13
IGL03157:Adam30 APN 3 98162296 missense possibly damaging 0.85
IGL03330:Adam30 APN 3 98162456 missense probably damaging 1.00
R0512:Adam30 UTSW 3 98162125 missense probably damaging 1.00
R1082:Adam30 UTSW 3 98162290 missense probably benign 0.30
R1173:Adam30 UTSW 3 98162906 missense probably benign 0.07
R1463:Adam30 UTSW 3 98162525 missense probably damaging 1.00
R1771:Adam30 UTSW 3 98161519 missense possibly damaging 0.94
R1862:Adam30 UTSW 3 98162113 nonsense probably null
R3442:Adam30 UTSW 3 98162570 missense probably benign 0.35
R4125:Adam30 UTSW 3 98161363 missense probably damaging 1.00
R4714:Adam30 UTSW 3 98162854 missense probably damaging 1.00
R4816:Adam30 UTSW 3 98162745 missense possibly damaging 0.68
R5447:Adam30 UTSW 3 98161343 missense probably benign 0.09
R5958:Adam30 UTSW 3 98161964 missense probably damaging 1.00
R6175:Adam30 UTSW 3 98162950 missense probably damaging 1.00
R6220:Adam30 UTSW 3 98161309 missense probably damaging 0.98
R6365:Adam30 UTSW 3 98161034 missense probably damaging 0.99
R6998:Adam30 UTSW 3 98162710 missense probably benign 0.03
R7086:Adam30 UTSW 3 98161319 missense probably damaging 1.00
R7290:Adam30 UTSW 3 98162941 missense probably benign 0.00
R7340:Adam30 UTSW 3 98162321 missense probably benign 0.14
R8181:Adam30 UTSW 3 98162975 missense probably benign
Z1176:Adam30 UTSW 3 98162360 missense possibly damaging 0.92
Z1177:Adam30 UTSW 3 98160979 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCGAACACGTGGTGTATCTC -3'
(R):5'- CCGGTGATGCATTGAGTTTC -3'

Sequencing Primer
(F):5'- CGAACACGTGGTGTATCTCGTAAC -3'
(R):5'- CTTTTGTAATGCACGAATTGACC -3'
Posted On2018-04-27