Incidental Mutation 'R6338:Agrn'
ID 514314
Institutional Source Beutler Lab
Gene Symbol Agrn
Ensembl Gene ENSMUSG00000041936
Gene Name agrin
Synonyms Agrin, NMF380, nmf380
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R6338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 156249747-156281945 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 156255042 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1614 (E1614K)
Ref Sequence ENSEMBL: ENSMUSP00000137931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071248] [ENSMUST00000105574] [ENSMUST00000105575] [ENSMUST00000180572]
AlphaFold A2ASQ1
Predicted Effect probably benign
Transcript: ENSMUST00000071248
SMART Domains Protein: ENSMUSP00000071229
Gene: ENSMUSG00000041936

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1139 5.57e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105574
AA Change: E1507K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000101199
Gene: ENSMUSG00000041936
AA Change: E1507K

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1136 2.26e-35 SMART
low complexity region 1142 1169 N/A INTRINSIC
low complexity region 1183 1198 N/A INTRINSIC
EGF 1214 1249 1.49e-4 SMART
LamG 1274 1410 4e-45 SMART
EGF 1434 1468 2.23e-3 SMART
EGF 1473 1507 7.13e-2 SMART
LamG 1542 1678 6.51e-36 SMART
EGF 1699 1735 4.35e-6 SMART
LamG 1771 1907 5.01e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105575
AA Change: E1507K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101200
Gene: ENSMUSG00000041936
AA Change: E1507K

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1136 2.26e-35 SMART
low complexity region 1142 1169 N/A INTRINSIC
low complexity region 1183 1198 N/A INTRINSIC
EGF 1214 1249 1.49e-4 SMART
LamG 1274 1410 4e-45 SMART
EGF 1434 1468 2.23e-3 SMART
EGF 1473 1507 7.13e-2 SMART
LamG 1542 1682 9.2e-36 SMART
EGF 1703 1739 4.35e-6 SMART
LamG 1794 1930 5.01e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154494
Predicted Effect probably benign
Transcript: ENSMUST00000180572
AA Change: E1614K

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137931
Gene: ENSMUSG00000041936
AA Change: E1614K

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NtA 32 159 5.1e-91 PFAM
FOLN 173 198 8.25e-6 SMART
KAZAL 198 244 1.22e-17 SMART
FOLN 249 273 7.58e-5 SMART
EGF_like 249 288 7.38e1 SMART
KAZAL 273 319 1.51e-13 SMART
KAZAL 348 391 1.8e-6 SMART
KAZAL 417 463 1.55e-10 SMART
FOLN 469 491 8.25e-6 SMART
KAZAL 491 536 1.14e-17 SMART
KAZAL 556 601 6.43e-17 SMART
FOLN 603 626 2.94e-2 SMART
KAZAL 614 666 8.96e-16 SMART
low complexity region 672 679 N/A INTRINSIC
KAZAL 706 752 1.12e-16 SMART
EGF_Lam 795 846 3.29e-15 SMART
EGF_Lam 849 893 6.7e-7 SMART
FOLN 902 924 1.94e-2 SMART
KAZAL 924 971 3.9e-16 SMART
low complexity region 996 1013 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
SEA 1121 1243 2.26e-35 SMART
low complexity region 1249 1276 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
EGF 1321 1356 1.49e-4 SMART
LamG 1381 1517 4e-45 SMART
EGF 1541 1575 2.23e-3 SMART
EGF 1580 1614 7.13e-2 SMART
LamG 1649 1785 6.51e-36 SMART
EGF 1806 1842 4.35e-6 SMART
LamG 1878 2014 5.01e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181062
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several proteins that are critical in the development of the neuromuscular junction (NMJ), as identified in mouse knock-out studies. The encoded protein contains several laminin G, Kazal type serine protease inhibitor, and epidermal growth factor domains. Additional post-translational modifications occur to add glycosaminoglycans and disulfide bonds. In one family with congenital myasthenic syndrome affecting limb-girdle muscles, a mutation in this gene was found. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Nullizygous mice display embryonic failure of NMJ formation, inability to breathe or move and perinatal lethality. Homozygotes for an ENU-induced allele show poor hindlimb motor control, myopathy, muscle atrophy, spasms and fiber-type switching, NMJ disaggregation, camptodactyly and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(1) Gene trapped(7)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adam30 T G 3: 98,068,857 (GRCm39) I102S probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arfgef2 A G 2: 166,687,490 (GRCm39) D238G probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cd209e T A 8: 3,899,154 (GRCm39) D186V probably damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cdh4 T C 2: 179,532,605 (GRCm39) V689A probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Csmd1 T G 8: 15,982,492 (GRCm39) K2725T possibly damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fam13a A G 6: 58,930,484 (GRCm39) V476A probably damaging Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gpatch2 G T 1: 186,957,711 (GRCm39) R22L probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Lrrcc1 T A 3: 14,612,376 (GRCm39) N376K possibly damaging Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1af1 A T 2: 37,109,834 (GRCm39) D111V probably damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Plcd1 G A 9: 118,904,059 (GRCm39) R292C probably damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Ubn2 A G 6: 38,467,649 (GRCm39) T788A probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Zc3h14 T A 12: 98,724,849 (GRCm39) D170E possibly damaging Het
Other mutations in Agrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Agrn APN 4 156,255,029 (GRCm39) splice site probably benign
IGL00811:Agrn APN 4 156,253,231 (GRCm39) missense possibly damaging 0.70
IGL01066:Agrn APN 4 156,261,800 (GRCm39) missense probably benign 0.00
IGL01412:Agrn APN 4 156,255,491 (GRCm39) splice site probably benign
IGL01414:Agrn APN 4 156,279,696 (GRCm39) splice site probably null
IGL02075:Agrn APN 4 156,254,667 (GRCm39) missense probably benign 0.40
IGL02609:Agrn APN 4 156,259,680 (GRCm39) splice site probably benign
IGL02669:Agrn APN 4 156,259,018 (GRCm39) splice site probably benign
IGL02671:Agrn APN 4 156,259,018 (GRCm39) splice site probably benign
IGL02672:Agrn APN 4 156,259,018 (GRCm39) splice site probably benign
IGL02674:Agrn APN 4 156,259,018 (GRCm39) splice site probably benign
IGL02724:Agrn APN 4 156,257,264 (GRCm39) nonsense probably null
IGL02804:Agrn APN 4 156,258,512 (GRCm39) missense probably benign 0.00
IGL02986:Agrn APN 4 156,263,311 (GRCm39) missense possibly damaging 0.84
IGL03160:Agrn APN 4 156,254,820 (GRCm39) missense probably damaging 0.98
BB004:Agrn UTSW 4 156,257,266 (GRCm39) missense probably damaging 0.99
BB014:Agrn UTSW 4 156,257,266 (GRCm39) missense probably damaging 0.99
F6893:Agrn UTSW 4 156,258,636 (GRCm39) missense probably benign
R0092:Agrn UTSW 4 156,263,410 (GRCm39) missense probably damaging 1.00
R0100:Agrn UTSW 4 156,259,415 (GRCm39) missense probably damaging 1.00
R0100:Agrn UTSW 4 156,259,415 (GRCm39) missense probably damaging 1.00
R0482:Agrn UTSW 4 156,258,012 (GRCm39) missense probably damaging 0.98
R0531:Agrn UTSW 4 156,263,891 (GRCm39) missense probably benign 0.38
R0536:Agrn UTSW 4 156,264,010 (GRCm39) missense probably benign 0.01
R0690:Agrn UTSW 4 156,258,910 (GRCm39) missense probably damaging 1.00
R0750:Agrn UTSW 4 156,251,394 (GRCm39) nonsense probably null
R1079:Agrn UTSW 4 156,261,682 (GRCm39) missense probably damaging 1.00
R1199:Agrn UTSW 4 156,256,756 (GRCm39) missense probably benign 0.00
R1222:Agrn UTSW 4 156,261,842 (GRCm39) missense probably damaging 0.99
R1534:Agrn UTSW 4 156,261,141 (GRCm39) missense probably damaging 1.00
R1587:Agrn UTSW 4 156,263,897 (GRCm39) missense probably damaging 0.99
R1625:Agrn UTSW 4 156,257,317 (GRCm39) missense probably damaging 1.00
R1698:Agrn UTSW 4 156,251,015 (GRCm39) missense probably benign 0.03
R1717:Agrn UTSW 4 156,250,976 (GRCm39) frame shift probably null
R1718:Agrn UTSW 4 156,250,976 (GRCm39) frame shift probably null
R1721:Agrn UTSW 4 156,259,630 (GRCm39) nonsense probably null
R1765:Agrn UTSW 4 156,261,284 (GRCm39) nonsense probably null
R1840:Agrn UTSW 4 156,251,872 (GRCm39) missense probably damaging 1.00
R1865:Agrn UTSW 4 156,250,976 (GRCm39) frame shift probably null
R2105:Agrn UTSW 4 156,261,756 (GRCm39) nonsense probably null
R2265:Agrn UTSW 4 156,263,675 (GRCm39) missense probably damaging 0.99
R2266:Agrn UTSW 4 156,263,675 (GRCm39) missense probably damaging 0.99
R2269:Agrn UTSW 4 156,263,675 (GRCm39) missense probably damaging 0.99
R2382:Agrn UTSW 4 156,260,973 (GRCm39) missense probably damaging 0.97
R2497:Agrn UTSW 4 156,258,268 (GRCm39) missense probably benign 0.28
R2509:Agrn UTSW 4 156,250,881 (GRCm39) splice site probably null
R2510:Agrn UTSW 4 156,250,881 (GRCm39) splice site probably null
R2511:Agrn UTSW 4 156,250,881 (GRCm39) splice site probably null
R2994:Agrn UTSW 4 156,251,785 (GRCm39) missense possibly damaging 0.79
R3824:Agrn UTSW 4 156,253,759 (GRCm39) missense probably damaging 1.00
R4736:Agrn UTSW 4 156,256,858 (GRCm39) missense probably benign 0.38
R4755:Agrn UTSW 4 156,257,979 (GRCm39) intron probably benign
R4853:Agrn UTSW 4 156,270,007 (GRCm39) critical splice donor site probably null
R4878:Agrn UTSW 4 156,255,302 (GRCm39) missense probably damaging 1.00
R5117:Agrn UTSW 4 156,270,010 (GRCm39) missense probably benign 0.30
R5228:Agrn UTSW 4 156,251,403 (GRCm39) missense probably damaging 1.00
R5236:Agrn UTSW 4 156,263,315 (GRCm39) missense possibly damaging 0.93
R5269:Agrn UTSW 4 156,253,447 (GRCm39) missense probably benign 0.10
R5282:Agrn UTSW 4 156,257,492 (GRCm39) missense probably damaging 1.00
R5449:Agrn UTSW 4 156,251,737 (GRCm39) critical splice donor site probably null
R5560:Agrn UTSW 4 156,262,954 (GRCm39) missense probably damaging 0.99
R5668:Agrn UTSW 4 156,251,770 (GRCm39) missense probably damaging 0.97
R5725:Agrn UTSW 4 156,258,332 (GRCm39) missense probably benign 0.25
R5967:Agrn UTSW 4 156,259,560 (GRCm39) missense probably damaging 1.00
R6226:Agrn UTSW 4 156,258,066 (GRCm39) missense probably damaging 0.96
R6351:Agrn UTSW 4 156,263,891 (GRCm39) missense probably benign 0.00
R6437:Agrn UTSW 4 156,261,235 (GRCm39) missense probably damaging 0.96
R6490:Agrn UTSW 4 156,251,819 (GRCm39) nonsense probably null
R6909:Agrn UTSW 4 156,261,464 (GRCm39) missense possibly damaging 0.90
R7110:Agrn UTSW 4 156,263,332 (GRCm39) missense possibly damaging 0.88
R7123:Agrn UTSW 4 156,257,297 (GRCm39) missense probably benign
R7163:Agrn UTSW 4 156,262,966 (GRCm39) missense probably damaging 1.00
R7180:Agrn UTSW 4 156,256,296 (GRCm39) missense probably benign 0.00
R7251:Agrn UTSW 4 156,259,063 (GRCm39) missense probably damaging 1.00
R7289:Agrn UTSW 4 156,263,389 (GRCm39) missense probably damaging 1.00
R7335:Agrn UTSW 4 156,260,989 (GRCm39) missense probably damaging 1.00
R7336:Agrn UTSW 4 156,259,371 (GRCm39) nonsense probably null
R7406:Agrn UTSW 4 156,256,758 (GRCm39) missense possibly damaging 0.93
R7460:Agrn UTSW 4 156,258,881 (GRCm39) missense probably damaging 0.98
R7531:Agrn UTSW 4 156,254,261 (GRCm39) missense probably damaging 1.00
R7585:Agrn UTSW 4 156,255,131 (GRCm39) missense probably benign 0.08
R7646:Agrn UTSW 4 156,279,811 (GRCm39) missense probably damaging 0.99
R7652:Agrn UTSW 4 156,253,675 (GRCm39) critical splice donor site probably null
R7714:Agrn UTSW 4 156,279,854 (GRCm39) missense probably damaging 1.00
R7751:Agrn UTSW 4 156,260,886 (GRCm39) missense probably damaging 1.00
R7852:Agrn UTSW 4 156,253,514 (GRCm39) missense probably benign 0.01
R7927:Agrn UTSW 4 156,257,266 (GRCm39) missense probably damaging 0.99
R8039:Agrn UTSW 4 156,253,468 (GRCm39) missense probably benign 0.12
R8056:Agrn UTSW 4 156,254,868 (GRCm39) missense probably benign
R8061:Agrn UTSW 4 156,263,411 (GRCm39) missense probably damaging 1.00
R8158:Agrn UTSW 4 156,258,346 (GRCm39) missense probably benign
R8159:Agrn UTSW 4 156,256,825 (GRCm39) missense probably benign 0.27
R8325:Agrn UTSW 4 156,258,119 (GRCm39) missense probably benign 0.01
R8338:Agrn UTSW 4 156,253,018 (GRCm39) missense probably benign 0.01
R8739:Agrn UTSW 4 156,257,045 (GRCm39) missense probably benign
R8956:Agrn UTSW 4 156,250,995 (GRCm39) missense probably damaging 0.99
R9094:Agrn UTSW 4 156,253,264 (GRCm39) missense probably benign 0.01
R9112:Agrn UTSW 4 156,261,514 (GRCm39) missense probably damaging 1.00
R9384:Agrn UTSW 4 156,257,106 (GRCm39) missense probably damaging 1.00
R9472:Agrn UTSW 4 156,254,841 (GRCm39) missense
R9619:Agrn UTSW 4 156,258,490 (GRCm39) missense probably benign 0.00
R9629:Agrn UTSW 4 156,257,094 (GRCm39) nonsense probably null
R9732:Agrn UTSW 4 156,258,446 (GRCm39) missense probably benign 0.13
R9749:Agrn UTSW 4 156,258,114 (GRCm39) missense probably benign 0.02
R9757:Agrn UTSW 4 156,261,235 (GRCm39) missense probably benign 0.03
R9792:Agrn UTSW 4 156,261,129 (GRCm39) missense probably benign 0.09
R9793:Agrn UTSW 4 156,261,129 (GRCm39) missense probably benign 0.09
Z1177:Agrn UTSW 4 156,264,033 (GRCm39) missense possibly damaging 0.95
Z1177:Agrn UTSW 4 156,256,001 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCAGCATTCTCCAGGACTATG -3'
(R):5'- GCTTTGGTGAGAACTAGCCTG -3'

Sequencing Primer
(F):5'- TCCAGGACTATGGAGGGC -3'
(R):5'- TGAGAACTAGCCTGGTGCC -3'
Posted On 2018-04-27