Incidental Mutation 'R6338:Krit1'
ID 514315
Institutional Source Beutler Lab
Gene Symbol Krit1
Ensembl Gene ENSMUSG00000000600
Gene Name KRIT1, ankyrin repeat containing
Synonyms Krit1B, A630036P20Rik, Krit1, Krit1A, Ccm1, 2010007K12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 3803184-3845564 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 3836857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 702 (M702R)
Ref Sequence ENSEMBL: ENSMUSP00000078985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080085] [ENSMUST00000171023] [ENSMUST00000200386] [ENSMUST00000200577]
AlphaFold Q6S5J6
Predicted Effect probably benign
Transcript: ENSMUST00000080085
AA Change: M702R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000078985
Gene: ENSMUSG00000000600
AA Change: M702R

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 3.8e-88 PFAM
ANK 287 316 1.04e2 SMART
ANK 320 350 4.5e-3 SMART
ANK 354 382 1.17e-1 SMART
B41 416 640 1.39e-39 SMART
Blast:B41 673 702 6e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171023
SMART Domains Protein: ENSMUSP00000132375
Gene: ENSMUSG00000000600

DomainStartEndE-ValueType
PDB:4DX8|K 1 198 1e-125 PDB
ANK 287 316 1.04e2 SMART
ANK 320 350 4.5e-3 SMART
ANK 354 382 1.17e-1 SMART
B41 416 640 1.39e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199845
Predicted Effect probably benign
Transcript: ENSMUST00000200386
SMART Domains Protein: ENSMUSP00000143559
Gene: ENSMUSG00000000600

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 8.1e-85 PFAM
ANK 306 334 7.5e-4 SMART
B41 368 592 9.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200577
SMART Domains Protein: ENSMUSP00000143776
Gene: ENSMUSG00000000600

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 1.8e-85 PFAM
Blast:B41 200 329 1e-82 BLAST
SCOP:d1ycsb1 291 329 2e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing four ankyrin repeats, a band 4.1/ezrin/radixin/moesin (FERM) domain, and multiple NPXY sequences. The encoded protein is localized in the nucleus and cytoplasm. It binds to integrin cytoplasmic domain-associated protein-1 alpha (ICAP1alpha), and plays a critical role in beta1-integrin-mediated cell proliferation. It associates with junction proteins and RAS-related protein 1A (Rap1A), which requires the encoded protein for maintaining the integrity of endothelial junctions. It is also a microtubule-associated protein and may play a role in microtubule targeting. Mutations in this gene result in cerebral cavernous malformations. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Targeted disruption of this gene results in embryonic lethality by E11. Embryos display prominent vascular defects that disrupt arterial modeling and phenocopy the human disorder of cerebral cavernous malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Krit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Krit1 APN 5 3812844 missense probably damaging 0.98
IGL02186:Krit1 APN 5 3809733 splice site probably benign
IGL02526:Krit1 APN 5 3822103 missense probably damaging 1.00
IGL03280:Krit1 APN 5 3811248 splice site probably benign
IGL03385:Krit1 APN 5 3807452 missense possibly damaging 0.51
Waspish UTSW 5 3831551 missense probably damaging 1.00
R0127:Krit1 UTSW 5 3822178 missense probably damaging 0.99
R0594:Krit1 UTSW 5 3823694 missense possibly damaging 0.71
R1157:Krit1 UTSW 5 3832176 missense probably damaging 1.00
R1777:Krit1 UTSW 5 3836799 missense probably damaging 0.96
R2115:Krit1 UTSW 5 3822108 nonsense probably null
R4021:Krit1 UTSW 5 3832132 missense probably benign 0.21
R4041:Krit1 UTSW 5 3809642 missense probably damaging 1.00
R4786:Krit1 UTSW 5 3812467 missense possibly damaging 0.86
R4989:Krit1 UTSW 5 3822238 missense probably damaging 1.00
R5217:Krit1 UTSW 5 3806451 nonsense probably null
R5304:Krit1 UTSW 5 3819326 missense probably damaging 0.99
R5371:Krit1 UTSW 5 3831551 missense probably damaging 1.00
R5682:Krit1 UTSW 5 3830737 missense probably damaging 0.99
R6248:Krit1 UTSW 5 3813032 splice site probably null
R7081:Krit1 UTSW 5 3823651 missense possibly damaging 0.71
R7454:Krit1 UTSW 5 3812474 missense probably damaging 0.99
R7497:Krit1 UTSW 5 3812349 missense possibly damaging 0.93
R7684:Krit1 UTSW 5 3830723 missense possibly damaging 0.75
R7780:Krit1 UTSW 5 3812772 missense probably damaging 1.00
R7862:Krit1 UTSW 5 3812788 missense probably damaging 0.99
R8041:Krit1 UTSW 5 3807309 missense probably benign
R8882:Krit1 UTSW 5 3836864 missense possibly damaging 0.72
R9034:Krit1 UTSW 5 3812996 intron probably benign
R9098:Krit1 UTSW 5 3813135 missense probably benign 0.00
R9328:Krit1 UTSW 5 3812577 critical splice donor site probably null
R9402:Krit1 UTSW 5 3822210 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCTTCAGGCTCTGTGAAGTTG -3'
(R):5'- GGCTCCTTTAATTAAGAAGGGAATCC -3'

Sequencing Primer
(F):5'- ACAAGGGTCTCATATAGCTGGTCTC -3'
(R):5'- CTAAAGGTTTCCAGGGAAG -3'
Posted On 2018-04-27