Mutagenetix > Incidental Mutations

Incidental Mutation 'R6338:Krit1'

514315

Institutional Source

Beutler Lab

Gene Symbol

Krit1

Ensembl Gene

ENSMUSG00000000600

Gene Name

KRIT1, ankyrin repeat containing

Synonyms

Krit1B, A630036P20Rik, Krit1, Krit1A, Ccm1, 2010007K12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6338 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3803184-3845564 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 3836857 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 702 (M702R)

Ref Sequence

ENSEMBL: ENSMUSP00000078985 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080085] [ENSMUST00000171023] [ENSMUST00000200386] [ENSMUST00000200577]

Predicted Effect

probably benign
Transcript: ENSMUST00000080085
AA Change: M702R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000078985
Gene: ENSMUSG00000000600
AA Change: M702R

Domain	Start	End	E-Value	Type
Pfam:NUDIX_5	22	198	3.8e-88	PFAM
ANK	287	316	1.04e2	SMART
ANK	320	350	4.5e-3	SMART
ANK	354	382	1.17e-1	SMART
B41	416	640	1.39e-39	SMART
Blast:B41	673	702	6e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000171023

SMART Domains

Protein: ENSMUSP00000132375
Gene: ENSMUSG00000000600

Domain	Start	End	E-Value	Type
PDB:4DX8\|K	1	198	1e-125	PDB
ANK	287	316	1.04e2	SMART
ANK	320	350	4.5e-3	SMART
ANK	354	382	1.17e-1	SMART
B41	416	640	1.39e-39	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199845

Predicted Effect

probably benign
Transcript: ENSMUST00000200386

SMART Domains

Protein: ENSMUSP00000143559
Gene: ENSMUSG00000000600

Domain	Start	End	E-Value	Type
Pfam:NUDIX_5	22	198	8.1e-85	PFAM
ANK	306	334	7.5e-4	SMART
B41	368	592	9.1e-42	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200577

SMART Domains

Protein: ENSMUSP00000143776
Gene: ENSMUSG00000000600

Domain	Start	End	E-Value	Type
Pfam:NUDIX_5	22	198	1.8e-85	PFAM
Blast:B41	200	329	1e-82	BLAST
SCOP:d1ycsb1	291	329	2e-8	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing four ankyrin repeats, a band 4.1/ezrin/radixin/moesin (FERM) domain, and multiple NPXY sequences. The encoded protein is localized in the nucleus and cytoplasm. It binds to integrin cytoplasmic domain-associated protein-1 alpha (ICAP1alpha), and plays a critical role in beta1-integrin-mediated cell proliferation. It associates with junction proteins and RAS-related protein 1A (Rap1A), which requires the encoded protein for maintaining the integrity of endothelial junctions. It is also a microtubule-associated protein and may play a role in microtubule targeting. Mutations in this gene result in cerebral cavernous malformations. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Targeted disruption of this gene results in embryonic lethality by E11. Embryos display prominent vascular defects that disrupt arterial modeling and phenocopy the human disorder of cerebral cavernous malformations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer3	T	C	7: 98,257,715	Y128C	probably damaging	Het
Adam30	T	G	3: 98,161,541	I102S	probably damaging	Het
Adcy8	A	T	15: 64,920,617	D163E	possibly damaging	Het
Agrn	C	T	4: 156,170,585	E1614K	probably benign	Het
Aldh16a1	A	T	7: 45,141,961	W107R	probably damaging	Het
Arfgef2	A	G	2: 166,845,570	D238G	probably damaging	Het
Arhgap11a	T	C	2: 113,833,725	S738G	probably benign	Het
Arid5b	C	A	10: 68,098,561	G504*	probably null	Het
Carmil3	T	C	14: 55,499,849	V763A	possibly damaging	Het
Cd209e	T	A	8: 3,849,154	D186V	probably damaging	Het
Cdh23	T	C	10: 60,413,151	D882G	probably damaging	Het
Cdh4	T	C	2: 179,890,812	V689A	probably damaging	Het
Cntn6	T	A	6: 104,726,139	V174E	probably damaging	Het
Col7a1	C	T	9: 108,956,633	T390M	unknown	Het
Crybg1	T	C	10: 43,992,509	D1017G	probably damaging	Het
Csmd1	T	G	8: 15,932,492	K2725T	possibly damaging	Het
Dnaaf2	T	C	12: 69,198,122	E55G	probably damaging	Het
Fam13a	A	G	6: 58,953,499	V476A	probably damaging	Het
Fem1b	A	T	9: 62,797,011	D322E	probably benign	Het
Frmpd1	G	A	4: 45,274,489	V466I	probably benign	Het
Gm11639	C	T	11: 104,843,208	R2027*	probably null	Het
Gm20671	A	T	5: 32,820,647	D1794E	probably damaging	Het
Gpatch2	G	T	1: 187,225,514	R22L	probably damaging	Het
Gtf2h1	A	G	7: 46,816,456	T450A	probably benign	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Krt34	T	C	11: 100,038,490	N298S	probably benign	Het
Lrrcc1	T	A	3: 14,547,316	N376K	possibly damaging	Het
Myo15	A	G	11: 60,478,133	E573G	probably damaging	Het
Olfr1224-ps1	T	A	2: 89,156,371	K268I	probably damaging	Het
Olfr1390	A	G	11: 49,340,867	S112G	probably benign	Het
Olfr366	A	T	2: 37,219,822	D111V	probably damaging	Het
Olfr391-ps	A	T	11: 73,799,319	L146Q	possibly damaging	Het
Olfr661	T	A	7: 104,688,171	V52E	possibly damaging	Het
Olfr736	T	A	14: 50,393,400	F215I	possibly damaging	Het
Phf20	A	T	2: 156,273,686	Q309L	possibly damaging	Het
Plcd1	G	A	9: 119,074,991	R292C	probably damaging	Het
Pold3	A	G	7: 100,088,105	V342A	possibly damaging	Het
Polr2a	A	T	11: 69,739,679		probably null	Het
Ptprcap	A	G	19: 4,156,224	E102G	probably benign	Het
Rab11fip5	T	C	6: 85,341,378	E843G	possibly damaging	Het
Rai14	T	C	15: 10,574,976	D632G	probably damaging	Het
Rnf149	A	T	1: 39,560,742	C268S	probably null	Het
Slc6a13	T	A	6: 121,334,839	F392I	probably damaging	Het
Slc7a11	C	T	3: 50,384,043		probably null	Het
Slf1	T	A	13: 77,084,462		probably null	Het
Stard9	G	A	2: 120,697,485	V1408I	probably benign	Het
Suclg1	T	C	6: 73,264,246	I183T	probably damaging	Het
Syne1	T	C	10: 5,255,475	E3497G	probably benign	Het
Tax1bp1	C	T	6: 52,729,376	R121*	probably null	Het
Tdpoz2	C	T	3: 93,652,336	V110I	probably benign	Het
Ubn2	A	G	6: 38,490,714	T788A	probably benign	Het
Unc13c	T	A	9: 73,734,447	I1255F	probably damaging	Het
Usp44	G	T	10: 93,846,513	R275I	probably damaging	Het
Uspl1	A	G	5: 149,215,034	N1015D	probably benign	Het
Wbp2nl	G	T	15: 82,299,045	W13C	possibly damaging	Het
Zc3h14	T	A	12: 98,758,590	D170E	possibly damaging	Het

Other mutations in Krit1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01088:Krit1	APN	5	3812844	missense	probably damaging	0.98
IGL02186:Krit1	APN	5	3809733	splice site	probably benign
IGL02526:Krit1	APN	5	3822103	missense	probably damaging	1.00
IGL03280:Krit1	APN	5	3811248	splice site	probably benign
IGL03385:Krit1	APN	5	3807452	missense	possibly damaging	0.51
Waspish	UTSW	5	3831551	missense	probably damaging	1.00
R0127:Krit1	UTSW	5	3822178	missense	probably damaging	0.99
R0594:Krit1	UTSW	5	3823694	missense	possibly damaging	0.71
R1157:Krit1	UTSW	5	3832176	missense	probably damaging	1.00
R1777:Krit1	UTSW	5	3836799	missense	probably damaging	0.96
R2115:Krit1	UTSW	5	3822108	nonsense	probably null
R4021:Krit1	UTSW	5	3832132	missense	probably benign	0.21
R4041:Krit1	UTSW	5	3809642	missense	probably damaging	1.00
R4786:Krit1	UTSW	5	3812467	missense	possibly damaging	0.86
R4989:Krit1	UTSW	5	3822238	missense	probably damaging	1.00
R5217:Krit1	UTSW	5	3806451	nonsense	probably null
R5304:Krit1	UTSW	5	3819326	missense	probably damaging	0.99
R5371:Krit1	UTSW	5	3831551	missense	probably damaging	1.00
R5682:Krit1	UTSW	5	3830737	missense	probably damaging	0.99
R6248:Krit1	UTSW	5	3813032	splice site	probably null
R7081:Krit1	UTSW	5	3823651	missense	possibly damaging	0.71
R7454:Krit1	UTSW	5	3812474	missense	probably damaging	0.99
R7497:Krit1	UTSW	5	3812349	missense	possibly damaging	0.93
R7684:Krit1	UTSW	5	3830723	missense	possibly damaging	0.75
R7780:Krit1	UTSW	5	3812772	missense	probably damaging	1.00
R7862:Krit1	UTSW	5	3812788	missense	probably damaging	0.99
R8041:Krit1	UTSW	5	3807309	missense	probably benign
R8882:Krit1	UTSW	5	3836864	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- CCTTCAGGCTCTGTGAAGTTG -3'
(R):5'- GGCTCCTTTAATTAAGAAGGGAATCC -3'

Sequencing Primer
(F):5'- ACAAGGGTCTCATATAGCTGGTCTC -3'
(R):5'- CTAAAGGTTTCCAGGGAAG -3'

Posted On

2018-04-27