Incidental Mutation 'R6338:Ubn2'
ID 514318
Institutional Source Beutler Lab
Gene Symbol Ubn2
Ensembl Gene ENSMUSG00000038538
Gene Name ubinuclein 2
Synonyms 2900060J04Rik, D130059P03Rik, 6030408G03Rik
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.883) question?
Stock # R6338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 38410860-38489698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38467649 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 788 (T788A)
Ref Sequence ENSEMBL: ENSMUSP00000036188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039127] [ENSMUST00000160583] [ENSMUST00000162593]
AlphaFold Q80WC1
Predicted Effect probably benign
Transcript: ENSMUST00000039127
AA Change: T788A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036188
Gene: ENSMUSG00000038538
AA Change: T788A

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 74 109 N/A INTRINSIC
Pfam:HUN 180 231 4.8e-22 PFAM
low complexity region 256 285 N/A INTRINSIC
low complexity region 294 309 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Pfam:UBN_AB 434 650 6.4e-80 PFAM
low complexity region 687 717 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
low complexity region 846 881 N/A INTRINSIC
low complexity region 1002 1042 N/A INTRINSIC
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1180 1199 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
low complexity region 1280 1297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159215
Predicted Effect probably benign
Transcript: ENSMUST00000159447
SMART Domains Protein: ENSMUSP00000123836
Gene: ENSMUSG00000038538

DomainStartEndE-ValueType
low complexity region 119 159 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159925
Predicted Effect probably benign
Transcript: ENSMUST00000160583
AA Change: T786A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124043
Gene: ENSMUSG00000038538
AA Change: T786A

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 74 109 N/A INTRINSIC
Pfam:HUN 178 232 3.8e-23 PFAM
low complexity region 256 285 N/A INTRINSIC
low complexity region 294 309 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Pfam:UBN_AB 434 650 2.9e-86 PFAM
low complexity region 685 715 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 844 879 N/A INTRINSIC
low complexity region 1000 1040 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1178 1197 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162423
Predicted Effect probably benign
Transcript: ENSMUST00000162593
AA Change: T635A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124352
Gene: ENSMUSG00000038538
AA Change: T635A

DomainStartEndE-ValueType
Pfam:HUN 10 64 4.4e-24 PFAM
low complexity region 88 117 N/A INTRINSIC
low complexity region 126 141 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 221 231 N/A INTRINSIC
Pfam:UBN_AB 266 482 3.1e-87 PFAM
low complexity region 534 564 N/A INTRINSIC
low complexity region 669 680 N/A INTRINSIC
low complexity region 693 728 N/A INTRINSIC
low complexity region 849 889 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
low complexity region 1027 1039 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adam30 T G 3: 98,068,857 (GRCm39) I102S probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Agrn C T 4: 156,255,042 (GRCm39) E1614K probably benign Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arfgef2 A G 2: 166,687,490 (GRCm39) D238G probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cd209e T A 8: 3,899,154 (GRCm39) D186V probably damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cdh4 T C 2: 179,532,605 (GRCm39) V689A probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Csmd1 T G 8: 15,982,492 (GRCm39) K2725T possibly damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fam13a A G 6: 58,930,484 (GRCm39) V476A probably damaging Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gpatch2 G T 1: 186,957,711 (GRCm39) R22L probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Lrrcc1 T A 3: 14,612,376 (GRCm39) N376K possibly damaging Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1af1 A T 2: 37,109,834 (GRCm39) D111V probably damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Plcd1 G A 9: 118,904,059 (GRCm39) R292C probably damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Zc3h14 T A 12: 98,724,849 (GRCm39) D170E possibly damaging Het
Other mutations in Ubn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Ubn2 APN 6 38,459,540 (GRCm39) missense possibly damaging 0.91
IGL03116:Ubn2 APN 6 38,468,834 (GRCm39) missense probably damaging 1.00
IGL03150:Ubn2 APN 6 38,440,649 (GRCm39) missense probably benign
IGL03382:Ubn2 APN 6 38,417,382 (GRCm39) unclassified probably benign
A4554:Ubn2 UTSW 6 38,461,045 (GRCm39) missense probably damaging 1.00
R0008:Ubn2 UTSW 6 38,411,535 (GRCm39) critical splice donor site probably null
R0034:Ubn2 UTSW 6 38,468,341 (GRCm39) synonymous silent
R0121:Ubn2 UTSW 6 38,429,793 (GRCm39) splice site probably benign
R0267:Ubn2 UTSW 6 38,459,553 (GRCm39) critical splice donor site probably null
R1864:Ubn2 UTSW 6 38,417,425 (GRCm39) missense possibly damaging 0.93
R1865:Ubn2 UTSW 6 38,417,425 (GRCm39) missense possibly damaging 0.93
R1892:Ubn2 UTSW 6 38,468,226 (GRCm39) missense probably damaging 1.00
R2174:Ubn2 UTSW 6 38,447,076 (GRCm39) splice site probably null
R2184:Ubn2 UTSW 6 38,461,029 (GRCm39) missense probably damaging 1.00
R2212:Ubn2 UTSW 6 38,475,674 (GRCm39) missense probably benign 0.03
R2442:Ubn2 UTSW 6 38,467,940 (GRCm39) missense probably benign 0.00
R3413:Ubn2 UTSW 6 38,475,674 (GRCm39) missense probably benign 0.03
R4725:Ubn2 UTSW 6 38,499,240 (GRCm39) utr 3 prime probably benign
R4765:Ubn2 UTSW 6 38,456,075 (GRCm39) missense probably damaging 1.00
R4771:Ubn2 UTSW 6 38,464,088 (GRCm39) splice site probably null
R4812:Ubn2 UTSW 6 38,440,661 (GRCm39) missense probably benign
R4934:Ubn2 UTSW 6 38,467,433 (GRCm39) missense probably benign 0.04
R5580:Ubn2 UTSW 6 38,460,187 (GRCm39) missense probably damaging 0.99
R5598:Ubn2 UTSW 6 38,467,323 (GRCm39) missense probably benign 0.00
R5672:Ubn2 UTSW 6 38,438,462 (GRCm39) missense probably damaging 1.00
R5715:Ubn2 UTSW 6 38,438,412 (GRCm39) nonsense probably null
R5817:Ubn2 UTSW 6 38,456,088 (GRCm39) missense probably damaging 1.00
R5919:Ubn2 UTSW 6 38,468,423 (GRCm39) missense possibly damaging 0.50
R5937:Ubn2 UTSW 6 38,440,917 (GRCm39) missense possibly damaging 0.74
R6033:Ubn2 UTSW 6 38,447,159 (GRCm39) critical splice donor site probably null
R6033:Ubn2 UTSW 6 38,447,159 (GRCm39) critical splice donor site probably null
R6174:Ubn2 UTSW 6 38,438,471 (GRCm39) missense probably damaging 1.00
R6653:Ubn2 UTSW 6 38,411,397 (GRCm39) missense possibly damaging 0.72
R7282:Ubn2 UTSW 6 38,429,811 (GRCm39) nonsense probably null
R7685:Ubn2 UTSW 6 38,468,727 (GRCm39) missense probably benign 0.02
R7727:Ubn2 UTSW 6 38,440,873 (GRCm39) missense probably benign 0.08
R7777:Ubn2 UTSW 6 38,467,688 (GRCm39) missense probably damaging 1.00
R8074:Ubn2 UTSW 6 38,417,475 (GRCm39) missense probably benign 0.13
R8218:Ubn2 UTSW 6 38,466,214 (GRCm39) missense probably benign 0.01
R8283:Ubn2 UTSW 6 38,475,663 (GRCm39) missense probably damaging 1.00
R9339:Ubn2 UTSW 6 38,460,079 (GRCm39) missense probably benign 0.17
R9781:Ubn2 UTSW 6 38,466,190 (GRCm39) missense probably benign
RF024:Ubn2 UTSW 6 38,440,563 (GRCm39) missense probably damaging 1.00
X0010:Ubn2 UTSW 6 38,460,055 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GATGACTCCCTCGATGAAGAC -3'
(R):5'- TGGCTTGACCTTTGCAGTCC -3'

Sequencing Primer
(F):5'- GATGACTCCCTCGATGAAGACCTTTC -3'
(R):5'- CTGGAGTAGCCTGGCTGG -3'
Posted On 2018-04-27