Incidental Mutation 'R6338:Tax1bp1'
ID514319
Institutional Source Beutler Lab
Gene Symbol Tax1bp1
Ensembl Gene ENSMUSG00000004535
Gene NameTax1 (human T cell leukemia virus type I) binding protein 1
Synonyms1700069J21Rik, 1200003J11Rik, D6Ertd404e, D6Ertd772e, T6BP, TXBP151
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6338 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location52713729-52766780 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 52729376 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 121 (R121*)
Ref Sequence ENSEMBL: ENSMUSP00000116059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080723] [ENSMUST00000129660] [ENSMUST00000138040] [ENSMUST00000149588]
Predicted Effect probably null
Transcript: ENSMUST00000080723
AA Change: R121*
SMART Domains Protein: ENSMUSP00000079548
Gene: ENSMUSG00000004535
AA Change: R121*

DomainStartEndE-ValueType
Pfam:CALCOCO1 15 416 2.6e-92 PFAM
coiled coil region 569 620 N/A INTRINSIC
ZnF_C2H2 753 778 7.57e1 SMART
ZnF_C2H2 780 805 3.21e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128173
Predicted Effect probably benign
Transcript: ENSMUST00000129660
SMART Domains Protein: ENSMUSP00000122922
Gene: ENSMUSG00000004535

DomainStartEndE-ValueType
Pfam:CALCOCO1 11 87 3.2e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000138040
AA Change: R121*
SMART Domains Protein: ENSMUSP00000119522
Gene: ENSMUSG00000004535
AA Change: R121*

DomainStartEndE-ValueType
Pfam:CALCOCO1 11 172 8.5e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149588
AA Change: R121*
SMART Domains Protein: ENSMUSP00000116059
Gene: ENSMUSG00000004535
AA Change: R121*

DomainStartEndE-ValueType
Pfam:CALCOCO1 11 161 2.3e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HTLV-1 tax1 binding protein. The encoded protein interacts with TNFAIP3, and inhibits TNF-induced apoptosis by mediating the TNFAIP3 anti-apoptotic activity. Degradation of this protein by caspase-3-like family proteins is associated with apoptosis induced by TNF. This protein may also have a role in the inhibition of inflammatory signaling pathways. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Knockout mice are born alive but fail to thrive and develop inflammatory cardiac valvulitis and dermatitis, die prematurely, and are hypersensitive to low doses of TNF and IL-1beta. In contrast, embryos homozygous for a gene trap mutation die at E13.5 from hemorrhaging and/or cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Tax1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Tax1bp1 APN 6 52753366 missense probably benign 0.16
IGL03177:Tax1bp1 APN 6 52736947 missense possibly damaging 0.95
R0836:Tax1bp1 UTSW 6 52741940 splice site probably benign
R1119:Tax1bp1 UTSW 6 52741948 splice site probably benign
R1456:Tax1bp1 UTSW 6 52744244 missense probably benign 0.01
R1465:Tax1bp1 UTSW 6 52727194 splice site probably benign
R1484:Tax1bp1 UTSW 6 52733320 missense probably damaging 0.99
R1661:Tax1bp1 UTSW 6 52736912 missense probably benign 0.18
R1665:Tax1bp1 UTSW 6 52736912 missense probably benign 0.18
R1712:Tax1bp1 UTSW 6 52729326 missense probably damaging 1.00
R1752:Tax1bp1 UTSW 6 52721413 missense probably damaging 1.00
R1913:Tax1bp1 UTSW 6 52765952 missense probably damaging 1.00
R2496:Tax1bp1 UTSW 6 52758357 critical splice donor site probably null
R3782:Tax1bp1 UTSW 6 52739548 missense probably damaging 1.00
R3804:Tax1bp1 UTSW 6 52742785 missense probably benign 0.45
R4238:Tax1bp1 UTSW 6 52766051 nonsense probably null
R4303:Tax1bp1 UTSW 6 52727278 missense possibly damaging 0.90
R4665:Tax1bp1 UTSW 6 52737131 missense probably benign 0.00
R4870:Tax1bp1 UTSW 6 52729493 intron probably benign
R5009:Tax1bp1 UTSW 6 52729493 intron probably benign
R5965:Tax1bp1 UTSW 6 52729332 missense probably damaging 1.00
R6313:Tax1bp1 UTSW 6 52744356 critical splice donor site probably null
R6328:Tax1bp1 UTSW 6 52746709 missense probably benign 0.03
R6886:Tax1bp1 UTSW 6 52733223 missense probably benign 0.43
R7251:Tax1bp1 UTSW 6 52721356 missense possibly damaging 0.95
R7531:Tax1bp1 UTSW 6 52746697 missense probably benign 0.00
R8225:Tax1bp1 UTSW 6 52744355 critical splice donor site probably null
RF020:Tax1bp1 UTSW 6 52721354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAGACAACTTTGGGCTATG -3'
(R):5'- GGCATAATCTGAAAATTCTCACAGC -3'

Sequencing Primer
(F):5'- ACAACTTTGGGCTATGTTTGAGAAG -3'
(R):5'- CTCACAGCTATCAACTGGATTAGG -3'
Posted On2018-04-27