Incidental Mutation 'R6338:Fam13a'
ID 514320
Institutional Source Beutler Lab
Gene Symbol Fam13a
Ensembl Gene ENSMUSG00000037709
Gene Name family with sequence similarity 13, member A
Synonyms D430015B01Rik
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 58910521-59001487 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58930484 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 476 (V476A)
Ref Sequence ENSEMBL: ENSMUSP00000134135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089860] [ENSMUST00000173193]
AlphaFold Q8BGI4
Predicted Effect probably damaging
Transcript: ENSMUST00000089860
AA Change: V476A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087304
Gene: ENSMUSG00000037709
AA Change: V476A

DomainStartEndE-ValueType
Blast:RhoGAP 19 128 6e-27 BLAST
low complexity region 136 147 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 173 185 N/A INTRINSIC
coiled coil region 336 363 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
coiled coil region 620 645 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173193
AA Change: V476A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134135
Gene: ENSMUSG00000037709
AA Change: V476A

DomainStartEndE-ValueType
Blast:RhoGAP 21 128 6e-27 BLAST
low complexity region 136 147 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 173 185 N/A INTRINSIC
coiled coil region 336 363 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
coiled coil region 592 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adam30 T G 3: 98,068,857 (GRCm39) I102S probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Agrn C T 4: 156,255,042 (GRCm39) E1614K probably benign Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arfgef2 A G 2: 166,687,490 (GRCm39) D238G probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cd209e T A 8: 3,899,154 (GRCm39) D186V probably damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cdh4 T C 2: 179,532,605 (GRCm39) V689A probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Csmd1 T G 8: 15,982,492 (GRCm39) K2725T possibly damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gpatch2 G T 1: 186,957,711 (GRCm39) R22L probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Lrrcc1 T A 3: 14,612,376 (GRCm39) N376K possibly damaging Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1af1 A T 2: 37,109,834 (GRCm39) D111V probably damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Plcd1 G A 9: 118,904,059 (GRCm39) R292C probably damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Ubn2 A G 6: 38,467,649 (GRCm39) T788A probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Zc3h14 T A 12: 98,724,849 (GRCm39) D170E possibly damaging Het
Other mutations in Fam13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Fam13a APN 6 58,923,111 (GRCm39) missense probably benign 0.03
IGL00467:Fam13a APN 6 58,917,098 (GRCm39) splice site probably benign
IGL01288:Fam13a APN 6 58,933,712 (GRCm39) missense probably damaging 1.00
IGL01503:Fam13a APN 6 58,933,065 (GRCm39) missense probably damaging 1.00
IGL01532:Fam13a APN 6 58,917,280 (GRCm39) missense probably damaging 0.96
IGL02197:Fam13a APN 6 58,912,586 (GRCm39) missense possibly damaging 0.65
IGL02206:Fam13a APN 6 58,964,204 (GRCm39) missense probably benign 0.00
IGL03189:Fam13a APN 6 58,933,843 (GRCm39) missense probably damaging 0.99
BB009:Fam13a UTSW 6 58,960,873 (GRCm39) critical splice donor site probably null
BB019:Fam13a UTSW 6 58,960,873 (GRCm39) critical splice donor site probably null
R0361:Fam13a UTSW 6 58,964,159 (GRCm39) missense probably benign
R0512:Fam13a UTSW 6 58,933,684 (GRCm39) missense probably damaging 1.00
R0801:Fam13a UTSW 6 58,960,997 (GRCm39) missense probably benign 0.01
R1222:Fam13a UTSW 6 58,912,707 (GRCm39) splice site probably benign
R1378:Fam13a UTSW 6 58,933,736 (GRCm39) missense probably benign 0.04
R1535:Fam13a UTSW 6 58,916,332 (GRCm39) missense probably damaging 0.99
R1614:Fam13a UTSW 6 58,917,169 (GRCm39) missense probably damaging 1.00
R1663:Fam13a UTSW 6 58,931,357 (GRCm39) nonsense probably null
R1809:Fam13a UTSW 6 58,942,045 (GRCm39) critical splice donor site probably null
R1905:Fam13a UTSW 6 58,930,475 (GRCm39) missense probably damaging 1.00
R2568:Fam13a UTSW 6 58,912,594 (GRCm39) missense probably damaging 1.00
R3771:Fam13a UTSW 6 58,964,171 (GRCm39) missense probably benign 0.11
R4654:Fam13a UTSW 6 58,964,152 (GRCm39) missense probably benign
R5244:Fam13a UTSW 6 58,930,459 (GRCm39) nonsense probably null
R5488:Fam13a UTSW 6 59,001,303 (GRCm39) missense probably null 1.00
R5489:Fam13a UTSW 6 59,001,303 (GRCm39) missense probably null 1.00
R5712:Fam13a UTSW 6 58,933,684 (GRCm39) missense probably damaging 1.00
R5729:Fam13a UTSW 6 58,916,292 (GRCm39) missense probably damaging 0.99
R5969:Fam13a UTSW 6 58,942,183 (GRCm39) missense probably damaging 1.00
R6074:Fam13a UTSW 6 58,966,723 (GRCm39) splice site probably null
R6275:Fam13a UTSW 6 58,931,242 (GRCm39) missense probably damaging 0.98
R6306:Fam13a UTSW 6 58,917,239 (GRCm39) missense probably benign 0.02
R6603:Fam13a UTSW 6 58,964,174 (GRCm39) missense probably benign 0.31
R7508:Fam13a UTSW 6 58,964,269 (GRCm39) missense probably damaging 1.00
R7516:Fam13a UTSW 6 58,932,248 (GRCm39) missense probably damaging 1.00
R7688:Fam13a UTSW 6 58,912,692 (GRCm39) missense probably benign 0.05
R7728:Fam13a UTSW 6 58,931,284 (GRCm39) missense possibly damaging 0.79
R7932:Fam13a UTSW 6 58,960,873 (GRCm39) critical splice donor site probably null
R8080:Fam13a UTSW 6 58,933,790 (GRCm39) missense probably damaging 1.00
R9494:Fam13a UTSW 6 58,930,508 (GRCm39) missense probably benign 0.00
R9671:Fam13a UTSW 6 58,951,014 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTGTGAATATGCATTAAGCTTCC -3'
(R):5'- GGTAGCTGATTACAATGGTCATCTG -3'

Sequencing Primer
(F):5'- GCATTAAGCTTCCTTTCTTGTACAAG -3'
(R):5'- GATTACAATGGTCATCTGCACTCTG -3'
Posted On 2018-04-27