Incidental Mutation 'R6338:Cd209e'
ID 514330
Institutional Source Beutler Lab
Gene Symbol Cd209e
Ensembl Gene ENSMUSG00000040197
Gene Name CD209e antigen
Synonyms SIGNR4, mSIGNR4
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.048) question?
Stock # R6338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 3897973-3904286 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3899154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 186 (D186V)
Ref Sequence ENSEMBL: ENSMUSP00000033888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033888]
AlphaFold Q91ZW7
Predicted Effect probably damaging
Transcript: ENSMUST00000033888
AA Change: D186V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033888
Gene: ENSMUSG00000040197
AA Change: D186V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 77 198 4.01e-33 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adam30 T G 3: 98,068,857 (GRCm39) I102S probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Agrn C T 4: 156,255,042 (GRCm39) E1614K probably benign Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arfgef2 A G 2: 166,687,490 (GRCm39) D238G probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cdh4 T C 2: 179,532,605 (GRCm39) V689A probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Csmd1 T G 8: 15,982,492 (GRCm39) K2725T possibly damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fam13a A G 6: 58,930,484 (GRCm39) V476A probably damaging Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gpatch2 G T 1: 186,957,711 (GRCm39) R22L probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Lrrcc1 T A 3: 14,612,376 (GRCm39) N376K possibly damaging Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1af1 A T 2: 37,109,834 (GRCm39) D111V probably damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Plcd1 G A 9: 118,904,059 (GRCm39) R292C probably damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Ubn2 A G 6: 38,467,649 (GRCm39) T788A probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Zc3h14 T A 12: 98,724,849 (GRCm39) D170E possibly damaging Het
Other mutations in Cd209e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Cd209e APN 8 3,902,800 (GRCm39) missense probably benign 0.05
IGL00920:Cd209e APN 8 3,899,187 (GRCm39) missense probably damaging 1.00
IGL01132:Cd209e APN 8 3,901,274 (GRCm39) missense probably benign 0.18
IGL02499:Cd209e APN 8 3,904,238 (GRCm39) missense probably benign
R0124:Cd209e UTSW 8 3,901,274 (GRCm39) missense probably benign 0.08
R0268:Cd209e UTSW 8 3,899,125 (GRCm39) missense probably benign 0.34
R0540:Cd209e UTSW 8 3,901,265 (GRCm39) missense probably benign 0.04
R0744:Cd209e UTSW 8 3,903,205 (GRCm39) missense probably benign 0.00
R0836:Cd209e UTSW 8 3,903,205 (GRCm39) missense probably benign 0.00
R1241:Cd209e UTSW 8 3,899,124 (GRCm39) missense probably damaging 0.99
R1367:Cd209e UTSW 8 3,899,084 (GRCm39) makesense probably null
R2040:Cd209e UTSW 8 3,899,158 (GRCm39) missense probably damaging 1.00
R2136:Cd209e UTSW 8 3,903,248 (GRCm39) missense probably benign 0.00
R4787:Cd209e UTSW 8 3,901,181 (GRCm39) missense probably null 0.69
R6283:Cd209e UTSW 8 3,899,212 (GRCm39) nonsense probably null
R6894:Cd209e UTSW 8 3,903,569 (GRCm39) missense possibly damaging 0.48
R8899:Cd209e UTSW 8 3,901,212 (GRCm39) nonsense probably null
R9594:Cd209e UTSW 8 3,901,183 (GRCm39) missense probably benign 0.00
Z1176:Cd209e UTSW 8 3,899,196 (GRCm39) missense probably benign 0.30
Z1177:Cd209e UTSW 8 3,901,181 (GRCm39) missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- CCATGCCCATAGACAGGGAG -3'
(R):5'- AAGACTTCATACGATGCAGGTAG -3'

Sequencing Primer
(F):5'- CCCATAGACAGGGAGTAGGAACTG -3'
(R):5'- AAGGTCTGTCCATCACGATG -3'
Posted On 2018-04-27