Mutagenetix > Incidental Mutation

Incidental Mutation 'R6338:Cd209e'

514330

Institutional Source

Beutler Lab

Gene Symbol

Cd209e

Ensembl Gene

ENSMUSG00000040197

Gene Name

CD209e antigen

Synonyms

mSIGNR4, SIGNR4

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.050) question?

Stock #

R6338 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3847965-3854309 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3849154 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 186 (D186V)

Ref Sequence

ENSEMBL: ENSMUSP00000033888 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033888]

AlphaFold

Q91ZW7

Predicted Effect

probably damaging
Transcript: ENSMUST00000033888
AA Change: D186V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000033888
Gene: ENSMUSG00000040197
AA Change: D186V

Domain	Start	End	E-Value	Type
transmembrane domain	15	37	N/A	INTRINSIC
CLECT	77	198	4.01e-33	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer3	T	C	7: 98,257,715	Y128C	probably damaging	Het
Adam30	T	G	3: 98,161,541	I102S	probably damaging	Het
Adcy8	A	T	15: 64,920,617	D163E	possibly damaging	Het
Agrn	C	T	4: 156,170,585	E1614K	probably benign	Het
Aldh16a1	A	T	7: 45,141,961	W107R	probably damaging	Het
Arfgef2	A	G	2: 166,845,570	D238G	probably damaging	Het
Arhgap11a	T	C	2: 113,833,725	S738G	probably benign	Het
Arid5b	C	A	10: 68,098,561	G504*	probably null	Het
Carmil3	T	C	14: 55,499,849	V763A	possibly damaging	Het
Cdh23	T	C	10: 60,413,151	D882G	probably damaging	Het
Cdh4	T	C	2: 179,890,812	V689A	probably damaging	Het
Cntn6	T	A	6: 104,726,139	V174E	probably damaging	Het
Col7a1	C	T	9: 108,956,633	T390M	unknown	Het
Crybg1	T	C	10: 43,992,509	D1017G	probably damaging	Het
Csmd1	T	G	8: 15,932,492	K2725T	possibly damaging	Het
Dnaaf2	T	C	12: 69,198,122	E55G	probably damaging	Het
Fam13a	A	G	6: 58,953,499	V476A	probably damaging	Het
Fem1b	A	T	9: 62,797,011	D322E	probably benign	Het
Frmpd1	G	A	4: 45,274,489	V466I	probably benign	Het
Gm11639	C	T	11: 104,843,208	R2027*	probably null	Het
Gm20671	A	T	5: 32,820,647	D1794E	probably damaging	Het
Gpatch2	G	T	1: 187,225,514	R22L	probably damaging	Het
Gtf2h1	A	G	7: 46,816,456	T450A	probably benign	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Krit1	T	G	5: 3,836,857	M702R	probably benign	Het
Krt34	T	C	11: 100,038,490	N298S	probably benign	Het
Lrrcc1	T	A	3: 14,547,316	N376K	possibly damaging	Het
Myo15	A	G	11: 60,478,133	E573G	probably damaging	Het
Olfr1224-ps1	T	A	2: 89,156,371	K268I	probably damaging	Het
Olfr1390	A	G	11: 49,340,867	S112G	probably benign	Het
Olfr366	A	T	2: 37,219,822	D111V	probably damaging	Het
Olfr391-ps	A	T	11: 73,799,319	L146Q	possibly damaging	Het
Olfr661	T	A	7: 104,688,171	V52E	possibly damaging	Het
Olfr736	T	A	14: 50,393,400	F215I	possibly damaging	Het
Phf20	A	T	2: 156,273,686	Q309L	possibly damaging	Het
Plcd1	G	A	9: 119,074,991	R292C	probably damaging	Het
Pold3	A	G	7: 100,088,105	V342A	possibly damaging	Het
Polr2a	A	T	11: 69,739,679		probably null	Het
Ptprcap	A	G	19: 4,156,224	E102G	probably benign	Het
Rab11fip5	T	C	6: 85,341,378	E843G	possibly damaging	Het
Rai14	T	C	15: 10,574,976	D632G	probably damaging	Het
Rnf149	A	T	1: 39,560,742	C268S	probably null	Het
Slc6a13	T	A	6: 121,334,839	F392I	probably damaging	Het
Slc7a11	C	T	3: 50,384,043		probably null	Het
Slf1	T	A	13: 77,084,462		probably null	Het
Stard9	G	A	2: 120,697,485	V1408I	probably benign	Het
Suclg1	T	C	6: 73,264,246	I183T	probably damaging	Het
Syne1	T	C	10: 5,255,475	E3497G	probably benign	Het
Tax1bp1	C	T	6: 52,729,376	R121*	probably null	Het
Tdpoz2	C	T	3: 93,652,336	V110I	probably benign	Het
Ubn2	A	G	6: 38,490,714	T788A	probably benign	Het
Unc13c	T	A	9: 73,734,447	I1255F	probably damaging	Het
Usp44	G	T	10: 93,846,513	R275I	probably damaging	Het
Uspl1	A	G	5: 149,215,034	N1015D	probably benign	Het
Wbp2nl	G	T	15: 82,299,045	W13C	possibly damaging	Het
Zc3h14	T	A	12: 98,758,590	D170E	possibly damaging	Het

Other mutations in Cd209e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Cd209e	APN	8	3852800	missense	probably benign	0.05
IGL00920:Cd209e	APN	8	3849187	missense	probably damaging	1.00
IGL01132:Cd209e	APN	8	3851274	missense	probably benign	0.18
IGL02499:Cd209e	APN	8	3854238	missense	probably benign
R0124:Cd209e	UTSW	8	3851274	missense	probably benign	0.08
R0268:Cd209e	UTSW	8	3849125	missense	probably benign	0.34
R0540:Cd209e	UTSW	8	3851265	missense	probably benign	0.04
R0744:Cd209e	UTSW	8	3853205	missense	probably benign	0.00
R0836:Cd209e	UTSW	8	3853205	missense	probably benign	0.00
R1241:Cd209e	UTSW	8	3849124	missense	probably damaging	0.99
R1367:Cd209e	UTSW	8	3849084	makesense	probably null
R2040:Cd209e	UTSW	8	3849158	missense	probably damaging	1.00
R2136:Cd209e	UTSW	8	3853248	missense	probably benign	0.00
R4787:Cd209e	UTSW	8	3851181	missense	probably null	0.69
R6283:Cd209e	UTSW	8	3849212	nonsense	probably null
R6894:Cd209e	UTSW	8	3853569	missense	possibly damaging	0.48
R8899:Cd209e	UTSW	8	3851212	nonsense	probably null
R9594:Cd209e	UTSW	8	3851183	missense	probably benign	0.00
Z1176:Cd209e	UTSW	8	3849196	missense	probably benign	0.30
Z1177:Cd209e	UTSW	8	3851181	missense	probably null	0.99

Predicted Primers

PCR Primer
(F):5'- CCATGCCCATAGACAGGGAG -3'
(R):5'- AAGACTTCATACGATGCAGGTAG -3'

Sequencing Primer
(F):5'- CCCATAGACAGGGAGTAGGAACTG -3'
(R):5'- AAGGTCTGTCCATCACGATG -3'

Posted On

2018-04-27