Incidental Mutation 'R6338:Csmd1'
ID 514331
Institutional Source Beutler Lab
Gene Symbol Csmd1
Ensembl Gene ENSMUSG00000060924
Gene Name CUB and Sushi multiple domains 1
Synonyms
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 15942537-17585602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 15982492 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 2725 (K2725T)
Ref Sequence ENSEMBL: ENSMUSP00000080751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082104]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000082104
AA Change: K2725T

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924
AA Change: K2725T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CUB 32 140 1.46e-26 SMART
CCP 145 202 1.01e-11 SMART
CUB 208 312 1.05e-27 SMART
CCP 349 406 1.28e-8 SMART
CUB 411 522 2.34e-25 SMART
CCP 527 580 1.22e-14 SMART
CUB 584 692 1.61e-37 SMART
CCP 697 754 4.41e-12 SMART
CUB 758 866 6.55e-38 SMART
CCP 873 926 2.53e-12 SMART
CUB 930 1040 8.94e-22 SMART
CCP 1045 1100 7.06e-11 SMART
CUB 1104 1212 3.14e-26 SMART
CCP 1217 1273 1.18e-12 SMART
CUB 1277 1386 9.72e-32 SMART
CCP 1391 1447 2.06e-12 SMART
CUB 1451 1559 1.68e-35 SMART
CCP 1564 1621 2.53e-12 SMART
CUB 1625 1733 4.24e-14 SMART
CCP 1741 1798 9.46e-12 SMART
CUB 1802 1910 4.23e-32 SMART
CCP 1915 1970 8.23e-12 SMART
CUB 1974 2082 8.59e-33 SMART
CCP 2087 2142 6.09e-15 SMART
CUB 2146 2253 2.36e-30 SMART
CCP 2258 2315 1.1e-12 SMART
CUB 2320 2430 4.3e-24 SMART
CCP 2432 2490 2.94e-8 SMART
CCP 2495 2552 2.03e-11 SMART
CCP 2557 2617 1.22e-5 SMART
CCP 2622 2675 2.72e-12 SMART
CCP 2680 2733 5.86e-17 SMART
CCP 2738 2791 6.09e-15 SMART
CCP 2796 2854 9.1e-14 SMART
CCP 2859 2912 3.96e-14 SMART
CCP 2920 2973 4.41e-12 SMART
CCP 2978 3032 2.94e-8 SMART
CCP 3037 3092 6.59e-11 SMART
CCP 3097 3150 4.12e-12 SMART
CCP 3155 3208 7.92e-14 SMART
CCP 3216 3270 2.8e-14 SMART
CCP 3275 3330 3.78e-11 SMART
transmembrane domain 3487 3509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125551
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adam30 T G 3: 98,068,857 (GRCm39) I102S probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Agrn C T 4: 156,255,042 (GRCm39) E1614K probably benign Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arfgef2 A G 2: 166,687,490 (GRCm39) D238G probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cd209e T A 8: 3,899,154 (GRCm39) D186V probably damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cdh4 T C 2: 179,532,605 (GRCm39) V689A probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fam13a A G 6: 58,930,484 (GRCm39) V476A probably damaging Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gpatch2 G T 1: 186,957,711 (GRCm39) R22L probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Lrrcc1 T A 3: 14,612,376 (GRCm39) N376K possibly damaging Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1af1 A T 2: 37,109,834 (GRCm39) D111V probably damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Plcd1 G A 9: 118,904,059 (GRCm39) R292C probably damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Ubn2 A G 6: 38,467,649 (GRCm39) T788A probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Zc3h14 T A 12: 98,724,849 (GRCm39) D170E possibly damaging Het
Other mutations in Csmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Csmd1 APN 8 16,059,297 (GRCm39) splice site probably benign
IGL00433:Csmd1 APN 8 16,281,387 (GRCm39) missense probably damaging 1.00
IGL00500:Csmd1 APN 8 15,971,139 (GRCm39) missense probably damaging 1.00
IGL00666:Csmd1 APN 8 16,240,004 (GRCm39) missense probably damaging 1.00
IGL00913:Csmd1 APN 8 16,121,301 (GRCm39) missense probably benign 0.00
IGL01012:Csmd1 APN 8 15,967,341 (GRCm39) missense probably benign 0.00
IGL01123:Csmd1 APN 8 17,584,944 (GRCm39) missense possibly damaging 0.96
IGL01348:Csmd1 APN 8 15,960,596 (GRCm39) missense probably damaging 0.99
IGL01444:Csmd1 APN 8 16,250,069 (GRCm39) missense probably benign 0.00
IGL01530:Csmd1 APN 8 15,953,195 (GRCm39) missense probably damaging 0.99
IGL01548:Csmd1 APN 8 16,338,660 (GRCm39) nonsense probably null
IGL01814:Csmd1 APN 8 16,551,389 (GRCm39) missense probably damaging 1.00
IGL01889:Csmd1 APN 8 16,048,857 (GRCm39) missense probably damaging 1.00
IGL02055:Csmd1 APN 8 16,119,015 (GRCm39) missense probably damaging 0.99
IGL02066:Csmd1 APN 8 15,976,594 (GRCm39) missense probably damaging 1.00
IGL02097:Csmd1 APN 8 16,261,773 (GRCm39) missense probably null 0.17
IGL02112:Csmd1 APN 8 16,131,719 (GRCm39) missense probably benign 0.18
IGL02161:Csmd1 APN 8 16,408,426 (GRCm39) missense probably damaging 0.97
IGL02189:Csmd1 APN 8 16,321,620 (GRCm39) missense probably damaging 0.99
IGL02272:Csmd1 APN 8 16,249,907 (GRCm39) missense probably damaging 0.99
IGL02292:Csmd1 APN 8 16,261,884 (GRCm39) missense probably damaging 1.00
IGL02385:Csmd1 APN 8 15,953,275 (GRCm39) missense probably benign 0.08
IGL02424:Csmd1 APN 8 16,142,340 (GRCm39) missense probably benign 0.22
IGL02492:Csmd1 APN 8 16,052,597 (GRCm39) missense probably benign 0.13
IGL02507:Csmd1 APN 8 17,584,992 (GRCm39) utr 5 prime probably benign
IGL02513:Csmd1 APN 8 16,049,869 (GRCm39) splice site probably benign
IGL02727:Csmd1 APN 8 16,281,341 (GRCm39) missense probably damaging 1.00
IGL02728:Csmd1 APN 8 16,049,779 (GRCm39) critical splice donor site probably null
IGL02852:Csmd1 APN 8 15,945,728 (GRCm39) missense probably damaging 0.99
IGL02935:Csmd1 APN 8 16,273,348 (GRCm39) missense probably damaging 1.00
IGL02945:Csmd1 APN 8 16,321,584 (GRCm39) missense possibly damaging 0.92
IGL02959:Csmd1 APN 8 15,960,465 (GRCm39) missense probably damaging 0.99
IGL03113:Csmd1 APN 8 16,078,712 (GRCm39) missense probably benign
IGL03129:Csmd1 APN 8 16,011,521 (GRCm39) missense probably damaging 0.99
IGL03131:Csmd1 APN 8 16,138,231 (GRCm39) missense probably damaging 1.00
IGL03275:Csmd1 APN 8 16,207,106 (GRCm39) missense probably benign 0.00
IGL03297:Csmd1 APN 8 16,059,432 (GRCm39) nonsense probably null
ikura UTSW 8 16,281,285 (GRCm39) missense probably damaging 1.00
I2289:Csmd1 UTSW 8 15,962,381 (GRCm39) missense probably benign 0.10
IGL03055:Csmd1 UTSW 8 16,145,515 (GRCm39) missense probably damaging 1.00
IGL03097:Csmd1 UTSW 8 15,995,127 (GRCm39) missense probably damaging 1.00
PIT4260001:Csmd1 UTSW 8 16,120,327 (GRCm39) missense probably damaging 1.00
PIT4378001:Csmd1 UTSW 8 15,945,728 (GRCm39) missense probably damaging 0.99
PIT4520001:Csmd1 UTSW 8 15,956,023 (GRCm39) missense probably benign 0.01
R0037:Csmd1 UTSW 8 15,967,248 (GRCm39) missense probably damaging 0.97
R0095:Csmd1 UTSW 8 16,283,065 (GRCm39) missense probably damaging 1.00
R0113:Csmd1 UTSW 8 16,034,849 (GRCm39) missense probably damaging 1.00
R0129:Csmd1 UTSW 8 16,129,956 (GRCm39) missense possibly damaging 0.95
R0144:Csmd1 UTSW 8 16,441,838 (GRCm39) missense probably benign 0.16
R0166:Csmd1 UTSW 8 16,283,036 (GRCm39) missense probably benign 0.29
R0227:Csmd1 UTSW 8 16,441,836 (GRCm39) missense probably benign 0.05
R0279:Csmd1 UTSW 8 16,273,249 (GRCm39) missense probably damaging 0.99
R0280:Csmd1 UTSW 8 16,321,616 (GRCm39) missense probably damaging 1.00
R0312:Csmd1 UTSW 8 16,034,760 (GRCm39) missense probably damaging 1.00
R0355:Csmd1 UTSW 8 15,968,330 (GRCm39) missense probably damaging 0.97
R0367:Csmd1 UTSW 8 15,967,270 (GRCm39) missense probably damaging 1.00
R0395:Csmd1 UTSW 8 16,396,652 (GRCm39) missense probably damaging 0.99
R0413:Csmd1 UTSW 8 16,760,530 (GRCm39) missense probably damaging 0.97
R0457:Csmd1 UTSW 8 16,551,407 (GRCm39) critical splice acceptor site probably null
R0463:Csmd1 UTSW 8 15,971,759 (GRCm39) missense probably damaging 0.99
R0482:Csmd1 UTSW 8 16,283,115 (GRCm39) missense probably damaging 1.00
R0501:Csmd1 UTSW 8 17,077,339 (GRCm39) missense probably damaging 0.97
R0505:Csmd1 UTSW 8 16,042,758 (GRCm39) missense probably damaging 1.00
R0507:Csmd1 UTSW 8 16,235,358 (GRCm39) splice site probably benign
R0511:Csmd1 UTSW 8 15,982,529 (GRCm39) missense possibly damaging 0.80
R0555:Csmd1 UTSW 8 16,235,287 (GRCm39) missense probably benign
R0580:Csmd1 UTSW 8 15,960,528 (GRCm39) missense probably damaging 1.00
R0610:Csmd1 UTSW 8 15,968,208 (GRCm39) missense possibly damaging 0.95
R0634:Csmd1 UTSW 8 16,276,405 (GRCm39) missense probably damaging 1.00
R0666:Csmd1 UTSW 8 16,119,063 (GRCm39) missense possibly damaging 0.88
R0674:Csmd1 UTSW 8 16,050,550 (GRCm39) missense probably benign 0.03
R0675:Csmd1 UTSW 8 16,208,145 (GRCm39) missense probably benign 0.01
R0763:Csmd1 UTSW 8 17,077,300 (GRCm39) missense possibly damaging 0.67
R0781:Csmd1 UTSW 8 15,971,174 (GRCm39) missense probably benign 0.35
R0862:Csmd1 UTSW 8 16,240,040 (GRCm39) missense probably damaging 0.99
R0864:Csmd1 UTSW 8 16,240,040 (GRCm39) missense probably damaging 0.99
R0925:Csmd1 UTSW 8 16,760,634 (GRCm39) missense probably benign 0.29
R0926:Csmd1 UTSW 8 16,083,590 (GRCm39) splice site probably null
R1005:Csmd1 UTSW 8 16,338,707 (GRCm39) missense probably damaging 0.99
R1073:Csmd1 UTSW 8 16,408,477 (GRCm39) splice site probably benign
R1185:Csmd1 UTSW 8 16,408,362 (GRCm39) missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16,408,362 (GRCm39) missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16,408,362 (GRCm39) missense probably damaging 0.96
R1256:Csmd1 UTSW 8 16,129,978 (GRCm39) missense probably damaging 1.00
R1294:Csmd1 UTSW 8 16,748,052 (GRCm39) missense probably damaging 0.99
R1375:Csmd1 UTSW 8 16,513,095 (GRCm39) splice site probably null
R1447:Csmd1 UTSW 8 15,975,306 (GRCm39) nonsense probably null
R1450:Csmd1 UTSW 8 15,995,180 (GRCm39) critical splice acceptor site probably null
R1470:Csmd1 UTSW 8 16,207,218 (GRCm39) splice site probably benign
R1580:Csmd1 UTSW 8 15,975,299 (GRCm39) missense probably damaging 1.00
R1591:Csmd1 UTSW 8 15,950,710 (GRCm39) missense probably damaging 0.99
R1658:Csmd1 UTSW 8 16,131,739 (GRCm39) missense possibly damaging 0.69
R1678:Csmd1 UTSW 8 15,968,252 (GRCm39) missense possibly damaging 0.58
R1717:Csmd1 UTSW 8 17,266,708 (GRCm39) missense possibly damaging 0.58
R1735:Csmd1 UTSW 8 15,982,610 (GRCm39) missense probably damaging 0.99
R1750:Csmd1 UTSW 8 15,967,303 (GRCm39) missense probably damaging 0.99
R1753:Csmd1 UTSW 8 16,207,134 (GRCm39) nonsense probably null
R1822:Csmd1 UTSW 8 16,273,340 (GRCm39) missense probably damaging 1.00
R1875:Csmd1 UTSW 8 15,979,101 (GRCm39) missense probably damaging 0.99
R1909:Csmd1 UTSW 8 15,956,116 (GRCm39) missense probably damaging 1.00
R1912:Csmd1 UTSW 8 16,284,012 (GRCm39) critical splice donor site probably null
R1993:Csmd1 UTSW 8 16,396,698 (GRCm39) missense probably damaging 0.99
R2067:Csmd1 UTSW 8 15,950,782 (GRCm39) missense probably benign
R2094:Csmd1 UTSW 8 16,129,992 (GRCm39) missense probably damaging 0.99
R2119:Csmd1 UTSW 8 17,266,749 (GRCm39) missense probably damaging 0.98
R2127:Csmd1 UTSW 8 15,967,392 (GRCm39) missense probably damaging 1.00
R2138:Csmd1 UTSW 8 15,979,088 (GRCm39) missense probably damaging 0.96
R2216:Csmd1 UTSW 8 17,077,355 (GRCm39) critical splice acceptor site probably null
R2220:Csmd1 UTSW 8 16,042,641 (GRCm39) missense possibly damaging 0.94
R2380:Csmd1 UTSW 8 16,240,101 (GRCm39) missense probably damaging 1.00
R2471:Csmd1 UTSW 8 16,261,776 (GRCm39) missense probably damaging 1.00
R2984:Csmd1 UTSW 8 16,003,782 (GRCm39) missense probably damaging 1.00
R3001:Csmd1 UTSW 8 16,246,184 (GRCm39) missense probably damaging 0.98
R3002:Csmd1 UTSW 8 16,246,184 (GRCm39) missense probably damaging 0.98
R3003:Csmd1 UTSW 8 16,246,184 (GRCm39) missense probably damaging 0.98
R3103:Csmd1 UTSW 8 15,967,405 (GRCm39) missense probably damaging 1.00
R3104:Csmd1 UTSW 8 17,077,247 (GRCm39) missense probably damaging 1.00
R3620:Csmd1 UTSW 8 16,042,684 (GRCm39) missense probably benign 0.29
R3621:Csmd1 UTSW 8 16,042,684 (GRCm39) missense probably benign 0.29
R3748:Csmd1 UTSW 8 15,956,071 (GRCm39) missense probably damaging 0.99
R3780:Csmd1 UTSW 8 16,252,000 (GRCm39) missense probably damaging 1.00
R3815:Csmd1 UTSW 8 16,052,522 (GRCm39) missense probably damaging 1.00
R3816:Csmd1 UTSW 8 16,052,522 (GRCm39) missense probably damaging 1.00
R3818:Csmd1 UTSW 8 16,052,522 (GRCm39) missense probably damaging 1.00
R3819:Csmd1 UTSW 8 16,052,522 (GRCm39) missense probably damaging 1.00
R3850:Csmd1 UTSW 8 16,129,936 (GRCm39) missense probably benign 0.00
R3945:Csmd1 UTSW 8 15,960,619 (GRCm39) splice site probably null
R3980:Csmd1 UTSW 8 15,956,056 (GRCm39) nonsense probably null
R4061:Csmd1 UTSW 8 15,995,158 (GRCm39) missense probably benign 0.00
R4086:Csmd1 UTSW 8 16,042,738 (GRCm39) missense probably damaging 0.99
R4087:Csmd1 UTSW 8 16,042,738 (GRCm39) missense probably damaging 0.99
R4089:Csmd1 UTSW 8 16,042,738 (GRCm39) missense probably damaging 0.99
R4183:Csmd1 UTSW 8 15,960,464 (GRCm39) missense probably damaging 0.99
R4226:Csmd1 UTSW 8 16,050,490 (GRCm39) missense probably damaging 0.99
R4454:Csmd1 UTSW 8 15,995,011 (GRCm39) missense probably damaging 0.99
R4533:Csmd1 UTSW 8 15,981,037 (GRCm39) splice site probably null
R4544:Csmd1 UTSW 8 16,760,652 (GRCm39) missense possibly damaging 0.93
R4547:Csmd1 UTSW 8 16,441,811 (GRCm39) missense possibly damaging 0.48
R4612:Csmd1 UTSW 8 15,971,908 (GRCm39) splice site probably null
R4620:Csmd1 UTSW 8 16,052,694 (GRCm39) critical splice acceptor site probably null
R4627:Csmd1 UTSW 8 16,747,933 (GRCm39) missense probably benign 0.00
R4633:Csmd1 UTSW 8 16,052,620 (GRCm39) missense probably damaging 0.99
R4646:Csmd1 UTSW 8 15,982,511 (GRCm39) missense possibly damaging 0.87
R4648:Csmd1 UTSW 8 16,048,788 (GRCm39) nonsense probably null
R4668:Csmd1 UTSW 8 16,073,905 (GRCm39) missense possibly damaging 0.50
R4709:Csmd1 UTSW 8 16,760,522 (GRCm39) critical splice donor site probably null
R4709:Csmd1 UTSW 8 16,073,905 (GRCm39) missense possibly damaging 0.96
R4741:Csmd1 UTSW 8 15,960,447 (GRCm39) missense probably damaging 0.99
R4774:Csmd1 UTSW 8 16,059,369 (GRCm39) missense probably benign 0.11
R4793:Csmd1 UTSW 8 16,138,277 (GRCm39) missense probably damaging 1.00
R4829:Csmd1 UTSW 8 16,177,310 (GRCm39) missense probably damaging 1.00
R4888:Csmd1 UTSW 8 15,945,674 (GRCm39) utr 3 prime probably benign
R4896:Csmd1 UTSW 8 16,059,439 (GRCm39) missense probably benign 0.00
R4932:Csmd1 UTSW 8 16,073,779 (GRCm39) missense probably damaging 0.99
R4944:Csmd1 UTSW 8 16,048,772 (GRCm39) missense probably damaging 1.00
R4953:Csmd1 UTSW 8 16,249,931 (GRCm39) missense probably damaging 0.99
R4996:Csmd1 UTSW 8 15,960,452 (GRCm39) missense probably damaging 0.97
R5028:Csmd1 UTSW 8 16,039,090 (GRCm39) missense probably damaging 1.00
R5146:Csmd1 UTSW 8 16,246,204 (GRCm39) missense probably damaging 1.00
R5272:Csmd1 UTSW 8 16,249,958 (GRCm39) missense probably damaging 0.99
R5327:Csmd1 UTSW 8 17,266,728 (GRCm39) missense possibly damaging 0.94
R5399:Csmd1 UTSW 8 16,760,613 (GRCm39) missense probably damaging 1.00
R5411:Csmd1 UTSW 8 15,960,471 (GRCm39) missense probably damaging 1.00
R5462:Csmd1 UTSW 8 16,011,486 (GRCm39) missense probably benign 0.12
R5463:Csmd1 UTSW 8 16,034,860 (GRCm39) missense probably benign 0.34
R5497:Csmd1 UTSW 8 16,135,195 (GRCm39) missense probably benign 0.20
R5536:Csmd1 UTSW 8 16,338,674 (GRCm39) missense probably damaging 0.99
R5711:Csmd1 UTSW 8 16,003,703 (GRCm39) missense probably damaging 1.00
R5730:Csmd1 UTSW 8 16,235,206 (GRCm39) nonsense probably null
R5788:Csmd1 UTSW 8 16,251,980 (GRCm39) missense probably damaging 1.00
R5941:Csmd1 UTSW 8 15,982,471 (GRCm39) missense probably damaging 0.99
R5960:Csmd1 UTSW 8 16,121,430 (GRCm39) missense possibly damaging 0.68
R5961:Csmd1 UTSW 8 16,120,366 (GRCm39) missense probably damaging 0.99
R5969:Csmd1 UTSW 8 16,121,367 (GRCm39) missense probably benign 0.00
R5998:Csmd1 UTSW 8 15,960,443 (GRCm39) missense probably damaging 1.00
R6062:Csmd1 UTSW 8 16,142,319 (GRCm39) missense possibly damaging 0.68
R6109:Csmd1 UTSW 8 16,249,874 (GRCm39) missense possibly damaging 0.93
R6116:Csmd1 UTSW 8 16,261,864 (GRCm39) missense probably damaging 1.00
R6143:Csmd1 UTSW 8 16,138,315 (GRCm39) missense probably damaging 1.00
R6155:Csmd1 UTSW 8 15,953,231 (GRCm39) missense probably benign 0.01
R6197:Csmd1 UTSW 8 15,976,611 (GRCm39) missense probably benign 0.32
R6247:Csmd1 UTSW 8 16,246,249 (GRCm39) missense possibly damaging 0.91
R6304:Csmd1 UTSW 8 16,108,688 (GRCm39) missense probably damaging 1.00
R6317:Csmd1 UTSW 8 16,760,658 (GRCm39) missense possibly damaging 0.89
R6318:Csmd1 UTSW 8 15,953,212 (GRCm39) missense probably damaging 1.00
R6369:Csmd1 UTSW 8 17,585,020 (GRCm39) start gained probably benign
R6447:Csmd1 UTSW 8 15,960,527 (GRCm39) missense probably damaging 1.00
R6454:Csmd1 UTSW 8 15,971,150 (GRCm39) missense probably damaging 0.99
R6494:Csmd1 UTSW 8 16,261,709 (GRCm39) splice site probably null
R6614:Csmd1 UTSW 8 17,266,803 (GRCm39) missense probably damaging 1.00
R6736:Csmd1 UTSW 8 16,052,626 (GRCm39) missense probably damaging 0.99
R6769:Csmd1 UTSW 8 16,121,408 (GRCm39) missense possibly damaging 0.80
R6771:Csmd1 UTSW 8 16,121,408 (GRCm39) missense possibly damaging 0.80
R6804:Csmd1 UTSW 8 16,087,260 (GRCm39) missense probably damaging 1.00
R6818:Csmd1 UTSW 8 16,235,341 (GRCm39) missense probably damaging 1.00
R6863:Csmd1 UTSW 8 17,584,929 (GRCm39) missense possibly damaging 0.85
R6930:Csmd1 UTSW 8 16,142,409 (GRCm39) missense probably damaging 0.97
R6969:Csmd1 UTSW 8 17,266,805 (GRCm39) missense possibly damaging 0.94
R7112:Csmd1 UTSW 8 16,151,142 (GRCm39) missense probably damaging 1.00
R7124:Csmd1 UTSW 8 15,953,202 (GRCm39) missense probably damaging 1.00
R7167:Csmd1 UTSW 8 15,976,524 (GRCm39) missense probably benign
R7243:Csmd1 UTSW 8 15,965,357 (GRCm39) missense probably damaging 1.00
R7260:Csmd1 UTSW 8 16,050,574 (GRCm39) missense probably damaging 1.00
R7271:Csmd1 UTSW 8 17,077,295 (GRCm39) missense probably damaging 0.99
R7324:Csmd1 UTSW 8 16,108,721 (GRCm39) missense probably damaging 1.00
R7325:Csmd1 UTSW 8 16,108,721 (GRCm39) missense probably damaging 1.00
R7327:Csmd1 UTSW 8 16,108,721 (GRCm39) missense probably damaging 1.00
R7373:Csmd1 UTSW 8 16,042,713 (GRCm39) missense probably damaging 1.00
R7406:Csmd1 UTSW 8 16,338,707 (GRCm39) missense probably damaging 0.99
R7427:Csmd1 UTSW 8 16,073,864 (GRCm39) missense possibly damaging 0.91
R7428:Csmd1 UTSW 8 16,073,864 (GRCm39) missense possibly damaging 0.91
R7445:Csmd1 UTSW 8 16,208,268 (GRCm39) missense possibly damaging 0.61
R7458:Csmd1 UTSW 8 16,003,738 (GRCm39) missense probably damaging 1.00
R7476:Csmd1 UTSW 8 15,945,731 (GRCm39) missense probably damaging 1.00
R7527:Csmd1 UTSW 8 16,261,732 (GRCm39) missense probably damaging 1.00
R7544:Csmd1 UTSW 8 16,142,310 (GRCm39) missense probably damaging 1.00
R7583:Csmd1 UTSW 8 16,048,833 (GRCm39) missense probably damaging 0.96
R7603:Csmd1 UTSW 8 16,338,696 (GRCm39) missense probably damaging 1.00
R7607:Csmd1 UTSW 8 15,968,331 (GRCm39) missense possibly damaging 0.94
R7642:Csmd1 UTSW 8 16,135,192 (GRCm39) missense probably damaging 0.99
R7669:Csmd1 UTSW 8 15,967,273 (GRCm39) missense probably damaging 1.00
R7720:Csmd1 UTSW 8 15,981,108 (GRCm39) missense probably damaging 1.00
R7728:Csmd1 UTSW 8 16,281,285 (GRCm39) missense probably damaging 1.00
R7738:Csmd1 UTSW 8 16,151,004 (GRCm39) missense probably damaging 1.00
R7745:Csmd1 UTSW 8 15,982,461 (GRCm39) critical splice donor site probably null
R7879:Csmd1 UTSW 8 16,441,820 (GRCm39) missense probably benign 0.28
R7884:Csmd1 UTSW 8 16,011,418 (GRCm39) missense probably damaging 1.00
R7897:Csmd1 UTSW 8 17,584,935 (GRCm39) missense possibly damaging 0.96
R8111:Csmd1 UTSW 8 15,967,306 (GRCm39) missense probably benign
R8119:Csmd1 UTSW 8 17,077,310 (GRCm39) missense probably damaging 0.99
R8134:Csmd1 UTSW 8 15,982,550 (GRCm39) missense probably damaging 0.99
R8187:Csmd1 UTSW 8 16,177,188 (GRCm39) missense probably damaging 0.99
R8196:Csmd1 UTSW 8 16,059,468 (GRCm39) missense probably benign 0.18
R8231:Csmd1 UTSW 8 16,747,939 (GRCm39) missense possibly damaging 0.82
R8242:Csmd1 UTSW 8 16,760,670 (GRCm39) missense probably benign 0.42
R8274:Csmd1 UTSW 8 15,960,453 (GRCm39) missense possibly damaging 0.93
R8286:Csmd1 UTSW 8 16,039,188 (GRCm39) missense probably benign 0.18
R8289:Csmd1 UTSW 8 16,108,716 (GRCm39) missense probably damaging 0.99
R8314:Csmd1 UTSW 8 16,208,258 (GRCm39) missense probably benign
R8323:Csmd1 UTSW 8 17,266,751 (GRCm39) nonsense probably null
R8387:Csmd1 UTSW 8 16,050,484 (GRCm39) missense possibly damaging 0.94
R8413:Csmd1 UTSW 8 15,950,676 (GRCm39) missense probably damaging 0.98
R8672:Csmd1 UTSW 8 15,976,598 (GRCm39) missense probably benign 0.01
R8765:Csmd1 UTSW 8 16,760,627 (GRCm39) nonsense probably null
R8789:Csmd1 UTSW 8 17,266,722 (GRCm39) missense probably damaging 0.99
R8828:Csmd1 UTSW 8 16,048,794 (GRCm39) missense probably benign 0.00
R8858:Csmd1 UTSW 8 16,120,318 (GRCm39) missense probably benign 0.10
R8878:Csmd1 UTSW 8 15,960,528 (GRCm39) missense probably damaging 1.00
R8911:Csmd1 UTSW 8 16,748,019 (GRCm39) missense probably damaging 0.99
R8966:Csmd1 UTSW 8 16,250,059 (GRCm39) missense probably damaging 1.00
R8978:Csmd1 UTSW 8 15,971,056 (GRCm39) missense probably benign 0.37
R8996:Csmd1 UTSW 8 15,971,105 (GRCm39) missense possibly damaging 0.54
R9045:Csmd1 UTSW 8 16,284,088 (GRCm39) missense probably damaging 0.99
R9084:Csmd1 UTSW 8 16,138,325 (GRCm39) missense probably benign
R9124:Csmd1 UTSW 8 16,034,806 (GRCm39) missense probably damaging 0.99
R9127:Csmd1 UTSW 8 16,273,286 (GRCm39) missense probably benign 0.31
R9146:Csmd1 UTSW 8 16,048,832 (GRCm39) missense probably benign 0.00
R9198:Csmd1 UTSW 8 15,962,430 (GRCm39) missense probably damaging 1.00
R9285:Csmd1 UTSW 8 15,956,088 (GRCm39) missense probably damaging 1.00
R9303:Csmd1 UTSW 8 16,011,532 (GRCm39) missense probably benign 0.31
R9305:Csmd1 UTSW 8 16,011,532 (GRCm39) missense probably benign 0.31
R9326:Csmd1 UTSW 8 16,049,803 (GRCm39) missense probably benign 0.21
R9356:Csmd1 UTSW 8 16,252,069 (GRCm39) missense probably damaging 1.00
R9385:Csmd1 UTSW 8 16,034,756 (GRCm39) missense probably benign 0.19
R9444:Csmd1 UTSW 8 16,208,250 (GRCm39) missense probably benign 0.30
R9476:Csmd1 UTSW 8 15,981,215 (GRCm39) critical splice acceptor site probably null
R9506:Csmd1 UTSW 8 16,250,023 (GRCm39) missense probably damaging 1.00
R9614:Csmd1 UTSW 8 16,208,239 (GRCm39) missense probably benign 0.00
R9668:Csmd1 UTSW 8 16,261,772 (GRCm39) missense probably benign 0.00
X0011:Csmd1 UTSW 8 16,246,277 (GRCm39) missense probably damaging 1.00
X0021:Csmd1 UTSW 8 16,235,270 (GRCm39) missense probably damaging 1.00
X0024:Csmd1 UTSW 8 16,087,232 (GRCm39) missense probably damaging 0.99
X0028:Csmd1 UTSW 8 15,965,333 (GRCm39) missense possibly damaging 0.79
Z1088:Csmd1 UTSW 8 16,239,992 (GRCm39) missense possibly damaging 0.50
Z1088:Csmd1 UTSW 8 16,142,272 (GRCm39) missense probably damaging 1.00
Z1088:Csmd1 UTSW 8 15,971,875 (GRCm39) missense possibly damaging 0.91
Z1088:Csmd1 UTSW 8 16,396,631 (GRCm39) missense probably damaging 0.99
Z1088:Csmd1 UTSW 8 16,250,072 (GRCm39) missense probably damaging 0.97
Z1176:Csmd1 UTSW 8 16,087,212 (GRCm39) missense probably damaging 1.00
Z1176:Csmd1 UTSW 8 16,048,814 (GRCm39) missense probably damaging 1.00
Z1177:Csmd1 UTSW 8 16,250,033 (GRCm39) missense probably damaging 1.00
Z1177:Csmd1 UTSW 8 16,034,708 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGGTGGGCTTGTACTC -3'
(R):5'- GGTGAATTGTGAATACCATGGGC -3'

Sequencing Primer
(F):5'- GGGCTTGTACTCTGATGGTAC -3'
(R):5'- GAATTGTGAATACCATGGGCTTATG -3'
Posted On 2018-04-27