Mutagenetix > Incidental Mutations

Incidental Mutation 'R6338:Unc13c'

514333

Institutional Source

Beutler Lab

Gene Symbol

Unc13c

Ensembl Gene

ENSMUSG00000062151

Gene Name

unc-13 homolog C (C. elegans)

Synonyms

Munc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6338 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73479422-73968966 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73734447 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1255 (I1255F)

Ref Sequence

ENSEMBL: ENSMUSP00000139027 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]

Predicted Effect

probably damaging
Transcript: ENSMUST00000075245
AA Change: I1255F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: I1255F

Domain	Start	End	E-Value	Type
low complexity region	109	127	N/A	INTRINSIC
low complexity region	153	164	N/A	INTRINSIC
low complexity region	273	287	N/A	INTRINSIC
low complexity region	464	491	N/A	INTRINSIC
low complexity region	678	694	N/A	INTRINSIC
C1	1094	1143	1.37e-17	SMART
C2	1217	1324	1.46e-22	SMART
DUF1041	1535	1642	3.18e-51	SMART
Blast:DUF1041	1714	1838	2e-49	BLAST
Pfam:Membr_traf_MHD	1883	2023	2.6e-50	PFAM
C2	2058	2164	4.15e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000184666
AA Change: I1255F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: I1255F

Domain	Start	End	E-Value	Type
low complexity region	109	127	N/A	INTRINSIC
low complexity region	153	164	N/A	INTRINSIC
low complexity region	273	287	N/A	INTRINSIC
low complexity region	464	491	N/A	INTRINSIC
low complexity region	678	694	N/A	INTRINSIC
C1	1094	1143	1.37e-17	SMART
C2	1217	1324	1.46e-22	SMART
DUF1041	1535	1642	3.18e-51	SMART
Blast:DUF1041	1714	1838	2e-49	BLAST
Pfam:Membr_traf_MHD	1882	2024	8.3e-59	PFAM
C2	2058	2164	4.15e-13	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer3	T	C	7: 98,257,715	Y128C	probably damaging	Het
Adam30	T	G	3: 98,161,541	I102S	probably damaging	Het
Adcy8	A	T	15: 64,920,617	D163E	possibly damaging	Het
Agrn	C	T	4: 156,170,585	E1614K	probably benign	Het
Aldh16a1	A	T	7: 45,141,961	W107R	probably damaging	Het
Arfgef2	A	G	2: 166,845,570	D238G	probably damaging	Het
Arhgap11a	T	C	2: 113,833,725	S738G	probably benign	Het
Arid5b	C	A	10: 68,098,561	G504*	probably null	Het
Carmil3	T	C	14: 55,499,849	V763A	possibly damaging	Het
Cd209e	T	A	8: 3,849,154	D186V	probably damaging	Het
Cdh23	T	C	10: 60,413,151	D882G	probably damaging	Het
Cdh4	T	C	2: 179,890,812	V689A	probably damaging	Het
Cntn6	T	A	6: 104,726,139	V174E	probably damaging	Het
Col7a1	C	T	9: 108,956,633	T390M	unknown	Het
Crybg1	T	C	10: 43,992,509	D1017G	probably damaging	Het
Csmd1	T	G	8: 15,932,492	K2725T	possibly damaging	Het
Dnaaf2	T	C	12: 69,198,122	E55G	probably damaging	Het
Fam13a	A	G	6: 58,953,499	V476A	probably damaging	Het
Fem1b	A	T	9: 62,797,011	D322E	probably benign	Het
Frmpd1	G	A	4: 45,274,489	V466I	probably benign	Het
Gm11639	C	T	11: 104,843,208	R2027*	probably null	Het
Gm20671	A	T	5: 32,820,647	D1794E	probably damaging	Het
Gpatch2	G	T	1: 187,225,514	R22L	probably damaging	Het
Gtf2h1	A	G	7: 46,816,456	T450A	probably benign	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Krit1	T	G	5: 3,836,857	M702R	probably benign	Het
Krt34	T	C	11: 100,038,490	N298S	probably benign	Het
Lrrcc1	T	A	3: 14,547,316	N376K	possibly damaging	Het
Myo15	A	G	11: 60,478,133	E573G	probably damaging	Het
Olfr1224-ps1	T	A	2: 89,156,371	K268I	probably damaging	Het
Olfr1390	A	G	11: 49,340,867	S112G	probably benign	Het
Olfr366	A	T	2: 37,219,822	D111V	probably damaging	Het
Olfr391-ps	A	T	11: 73,799,319	L146Q	possibly damaging	Het
Olfr661	T	A	7: 104,688,171	V52E	possibly damaging	Het
Olfr736	T	A	14: 50,393,400	F215I	possibly damaging	Het
Phf20	A	T	2: 156,273,686	Q309L	possibly damaging	Het
Plcd1	G	A	9: 119,074,991	R292C	probably damaging	Het
Pold3	A	G	7: 100,088,105	V342A	possibly damaging	Het
Polr2a	A	T	11: 69,739,679		probably null	Het
Ptprcap	A	G	19: 4,156,224	E102G	probably benign	Het
Rab11fip5	T	C	6: 85,341,378	E843G	possibly damaging	Het
Rai14	T	C	15: 10,574,976	D632G	probably damaging	Het
Rnf149	A	T	1: 39,560,742	C268S	probably null	Het
Slc6a13	T	A	6: 121,334,839	F392I	probably damaging	Het
Slc7a11	C	T	3: 50,384,043		probably null	Het
Slf1	T	A	13: 77,084,462		probably null	Het
Stard9	G	A	2: 120,697,485	V1408I	probably benign	Het
Suclg1	T	C	6: 73,264,246	I183T	probably damaging	Het
Syne1	T	C	10: 5,255,475	E3497G	probably benign	Het
Tax1bp1	C	T	6: 52,729,376	R121*	probably null	Het
Tdpoz2	C	T	3: 93,652,336	V110I	probably benign	Het
Ubn2	A	G	6: 38,490,714	T788A	probably benign	Het
Usp44	G	T	10: 93,846,513	R275I	probably damaging	Het
Uspl1	A	G	5: 149,215,034	N1015D	probably benign	Het
Wbp2nl	G	T	15: 82,299,045	W13C	possibly damaging	Het
Zc3h14	T	A	12: 98,758,590	D170E	possibly damaging	Het

Other mutations in Unc13c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Unc13c	APN	9	73736703	missense	probably damaging	0.99
IGL00693:Unc13c	APN	9	73758602	missense	probably benign	0.18
IGL01022:Unc13c	APN	9	73517328	missense	probably benign	0.06
IGL01088:Unc13c	APN	9	73932281	missense	possibly damaging	0.63
IGL01123:Unc13c	APN	9	73933197	missense	probably benign	0.05
IGL01131:Unc13c	APN	9	73564053	missense	probably benign
IGL01135:Unc13c	APN	9	73484893	missense	probably damaging	1.00
IGL01393:Unc13c	APN	9	73540270	missense	probably benign	0.06
IGL01752:Unc13c	APN	9	73931811	missense	probably benign	0.01
IGL01893:Unc13c	APN	9	73693366	missense	probably benign	0.15
IGL01897:Unc13c	APN	9	73546027	missense	probably damaging	0.99
IGL01936:Unc13c	APN	9	73693242	missense	probably benign	0.07
IGL02122:Unc13c	APN	9	73734397	splice site	probably benign
IGL02341:Unc13c	APN	9	73933210	missense	possibly damaging	0.76
IGL02434:Unc13c	APN	9	73932628	missense	probably benign	0.01
IGL02545:Unc13c	APN	9	73481075	missense	probably damaging	0.98
IGL02709:Unc13c	APN	9	73558956	missense	probably benign	0.00
IGL02815:Unc13c	APN	9	73540263	missense	possibly damaging	0.83
IGL02904:Unc13c	APN	9	73481067	nonsense	probably null
IGL03117:Unc13c	APN	9	73534025	missense	probably benign	0.03
IGL03260:Unc13c	APN	9	73931344	missense	probably benign	0.11
PIT4431001:Unc13c	UTSW	9	73749547	missense	probably damaging	0.99
PIT4651001:Unc13c	UTSW	9	73483739	missense	possibly damaging	0.48
R0017:Unc13c	UTSW	9	73693301	missense	probably benign	0.07
R0039:Unc13c	UTSW	9	73669565	splice site	probably benign
R0164:Unc13c	UTSW	9	73694892	missense	probably benign	0.01
R0164:Unc13c	UTSW	9	73694892	missense	probably benign	0.01
R0308:Unc13c	UTSW	9	73481118	missense	probably benign	0.04
R0344:Unc13c	UTSW	9	73930785	missense	probably benign	0.39
R0421:Unc13c	UTSW	9	73933210	missense	possibly damaging	0.76
R0606:Unc13c	UTSW	9	73530983	splice site	probably benign
R0655:Unc13c	UTSW	9	73930953	missense	probably damaging	0.96
R1013:Unc13c	UTSW	9	73933332	missense	probably benign	0.45
R1293:Unc13c	UTSW	9	73574074	missense	probably benign	0.06
R1493:Unc13c	UTSW	9	73639068	missense	probably benign	0.27
R1675:Unc13c	UTSW	9	73639050	critical splice donor site	probably null
R1789:Unc13c	UTSW	9	73756339	missense	possibly damaging	0.92
R2001:Unc13c	UTSW	9	73483615	splice site	probably null
R2055:Unc13c	UTSW	9	73736550	missense	probably damaging	1.00
R2060:Unc13c	UTSW	9	73665656	missense	probably damaging	0.99
R2420:Unc13c	UTSW	9	73931547	missense	probably damaging	0.97
R2421:Unc13c	UTSW	9	73931547	missense	probably damaging	0.97
R2422:Unc13c	UTSW	9	73931547	missense	probably damaging	0.97
R3415:Unc13c	UTSW	9	73932586	missense	probably benign	0.00
R3423:Unc13c	UTSW	9	73930653	missense	possibly damaging	0.46
R3820:Unc13c	UTSW	9	73930958	missense	probably benign	0.00
R3857:Unc13c	UTSW	9	73699108	nonsense	probably null
R3859:Unc13c	UTSW	9	73699108	nonsense	probably null
R3895:Unc13c	UTSW	9	73933523	missense	probably benign
R4038:Unc13c	UTSW	9	73533906	critical splice donor site	probably null
R4077:Unc13c	UTSW	9	73736539	nonsense	probably null
R4125:Unc13c	UTSW	9	73574007	critical splice donor site	probably null
R4128:Unc13c	UTSW	9	73734537	missense	probably damaging	1.00
R4235:Unc13c	UTSW	9	73530952	missense	possibly damaging	0.68
R4295:Unc13c	UTSW	9	73734504	missense	probably damaging	1.00
R4307:Unc13c	UTSW	9	73693367	missense	probably benign	0.06
R4658:Unc13c	UTSW	9	73932826	missense	probably damaging	1.00
R4694:Unc13c	UTSW	9	73572354	missense	probably benign	0.00
R4735:Unc13c	UTSW	9	73693338	missense	probably benign	0.00
R4744:Unc13c	UTSW	9	73931844	missense	probably damaging	1.00
R4795:Unc13c	UTSW	9	73932187	missense	probably damaging	0.97
R4827:Unc13c	UTSW	9	73931286	missense	probably damaging	1.00
R4838:Unc13c	UTSW	9	73932072	missense	possibly damaging	0.68
R4869:Unc13c	UTSW	9	73680434	missense	probably benign	0.02
R4873:Unc13c	UTSW	9	73517284	missense	probably damaging	0.98
R4875:Unc13c	UTSW	9	73517284	missense	probably damaging	0.98
R4876:Unc13c	UTSW	9	73749539	missense	probably damaging	1.00
R4905:Unc13c	UTSW	9	73680392	missense	probably benign
R4912:Unc13c	UTSW	9	73574022	missense	probably damaging	0.99
R5026:Unc13c	UTSW	9	73930903	missense	possibly damaging	0.74
R5127:Unc13c	UTSW	9	73933372	missense	probably benign	0.26
R5151:Unc13c	UTSW	9	73931475	missense	probably benign	0.02
R5171:Unc13c	UTSW	9	73757954	missense	probably benign
R5244:Unc13c	UTSW	9	73525951	critical splice donor site	probably null
R5342:Unc13c	UTSW	9	73930823	missense	probably benign	0.00
R5399:Unc13c	UTSW	9	73749688	missense	possibly damaging	0.95
R5409:Unc13c	UTSW	9	73578390	missense	possibly damaging	0.78
R5460:Unc13c	UTSW	9	73545989	missense	probably benign
R5680:Unc13c	UTSW	9	73932602	missense	probably damaging	1.00
R5681:Unc13c	UTSW	9	73546075	splice site	probably null
R5728:Unc13c	UTSW	9	73558956	missense	probably benign	0.01
R5762:Unc13c	UTSW	9	73812367	missense	probably benign	0.00
R5764:Unc13c	UTSW	9	73533903	splice site	probably null
R5829:Unc13c	UTSW	9	73693368	missense	probably benign	0.15
R5894:Unc13c	UTSW	9	73693204	critical splice donor site	probably null
R5936:Unc13c	UTSW	9	73578492	missense	probably damaging	1.00
R6043:Unc13c	UTSW	9	73736651	missense	possibly damaging	0.88
R6046:Unc13c	UTSW	9	73930884	missense	probably benign
R6148:Unc13c	UTSW	9	73693366	missense	probably benign	0.15
R6207:Unc13c	UTSW	9	73758628	missense	possibly damaging	0.89
R6277:Unc13c	UTSW	9	73699169	missense	probably damaging	1.00
R6615:Unc13c	UTSW	9	73930608	missense	possibly damaging	0.63
R6978:Unc13c	UTSW	9	73931977	missense	probably benign	0.39
R7053:Unc13c	UTSW	9	73932297	missense	probably damaging	1.00
R7223:Unc13c	UTSW	9	73629191	missense	probably benign	0.44
R7259:Unc13c	UTSW	9	73517363	missense	probably benign	0.00
R7353:Unc13c	UTSW	9	73574073	missense	probably benign	0.00
R7357:Unc13c	UTSW	9	73933528	small insertion	probably benign
R7357:Unc13c	UTSW	9	73933529	small insertion	probably benign
R7607:Unc13c	UTSW	9	73669535	missense	probably damaging	0.98
R7626:Unc13c	UTSW	9	73734517	missense	probably damaging	1.00
R7639:Unc13c	UTSW	9	73933168	missense	probably damaging	0.99
R7657:Unc13c	UTSW	9	73533903	splice site	probably null
R7665:Unc13c	UTSW	9	73680474	missense	probably benign	0.28
R7704:Unc13c	UTSW	9	73699212	missense	probably benign	0.27
R7776:Unc13c	UTSW	9	73694950	missense	probably damaging	1.00
R7811:Unc13c	UTSW	9	73693271	missense	possibly damaging	0.46
R7833:Unc13c	UTSW	9	73481109	missense	possibly damaging	0.53
R7839:Unc13c	UTSW	9	73933314	missense	possibly damaging	0.63
R7869:Unc13c	UTSW	9	73694877	missense	probably damaging	1.00
R7916:Unc13c	UTSW	9	73481109	missense	possibly damaging	0.53
R7922:Unc13c	UTSW	9	73933314	missense	possibly damaging	0.63
R7952:Unc13c	UTSW	9	73694877	missense	probably damaging	1.00
R8047:Unc13c	UTSW	9	73812354	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCAATGCTGCCCTAAATGTAC -3'
(R):5'- TGCAAACCCAGGGTAAAATGAC -3'

Sequencing Primer
(F):5'- GCTGCCCTAAATGTACTTCTAAAGAG -3'
(R):5'- GACAGAAAACATTCTCTCTGATGG -3'

Posted On

2018-04-27