Incidental Mutation 'R6338:Plcd1'
ID 514335
Institutional Source Beutler Lab
Gene Symbol Plcd1
Ensembl Gene ENSMUSG00000010660
Gene Name phospholipase C, delta 1
Synonyms PLC-delta 1
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.331) question?
Stock # R6338 (G1)
Quality Score 191.009
Status Not validated
Chromosome 9
Chromosomal Location 118900595-118922570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 118904059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 292 (R292C)
Ref Sequence ENSEMBL: ENSMUSP00000149676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010804] [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000141185] [ENSMUST00000213464] [ENSMUST00000214470]
AlphaFold Q8R3B1
Predicted Effect possibly damaging
Transcript: ENSMUST00000010804
AA Change: R292C

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000010804
Gene: ENSMUSG00000010660
AA Change: R292C

DomainStartEndE-ValueType
PH 22 132 9.41e-10 SMART
EFh 144 172 2.87e-2 SMART
EFh 180 208 9.34e1 SMART
Pfam:EF-hand_like 213 295 1.2e-23 PFAM
PLCXc 296 440 5.47e-94 SMART
low complexity region 461 472 N/A INTRINSIC
PLCYc 492 609 1.22e-68 SMART
C2 630 735 1.78e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051386
SMART Domains Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
GEL 613 706 7.8e-16 SMART
VHP 824 859 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074734
SMART Domains Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
VHP 740 775 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126251
SMART Domains Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
Blast:GEL 1 56 9e-21 BLAST
GEL 63 149 4.38e-19 SMART
GEL 168 261 7.8e-16 SMART
VHP 357 392 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141185
SMART Domains Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 7 104 7.92e-17 SMART
GEL 124 210 4.38e-19 SMART
GEL 229 322 7.8e-16 SMART
VHP 440 475 2.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153630
Predicted Effect probably damaging
Transcript: ENSMUST00000213464
AA Change: R292C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000214470
AA Change: R318C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214491
Meta Mutation Damage Score 0.2510 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family. Phospholipase C isozymes play critical roles in intracellular signal transduction by catalyzing the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) into the second messengers diacylglycerol (DAG) and inositol triphosphate (IP3). The encoded protein functions as a tumor suppressor in several types of cancer, and mutations in this gene are a cause of hereditary leukonychia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene show reduced body size and various abnormalities of the skin and hair including alopecia, epidermal hyperplasia, enlarged sebaceous glands, various kinds of cysts, and skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adam30 T G 3: 98,068,857 (GRCm39) I102S probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Agrn C T 4: 156,255,042 (GRCm39) E1614K probably benign Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arfgef2 A G 2: 166,687,490 (GRCm39) D238G probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cd209e T A 8: 3,899,154 (GRCm39) D186V probably damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cdh4 T C 2: 179,532,605 (GRCm39) V689A probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Csmd1 T G 8: 15,982,492 (GRCm39) K2725T possibly damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fam13a A G 6: 58,930,484 (GRCm39) V476A probably damaging Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gpatch2 G T 1: 186,957,711 (GRCm39) R22L probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Lrrcc1 T A 3: 14,612,376 (GRCm39) N376K possibly damaging Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1af1 A T 2: 37,109,834 (GRCm39) D111V probably damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Ubn2 A G 6: 38,467,649 (GRCm39) T788A probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Zc3h14 T A 12: 98,724,849 (GRCm39) D170E possibly damaging Het
Other mutations in Plcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Plcd1 APN 9 118,905,246 (GRCm39) missense probably damaging 1.00
IGL01634:Plcd1 APN 9 118,902,857 (GRCm39) missense probably damaging 0.99
IGL01992:Plcd1 APN 9 118,905,053 (GRCm39) missense probably benign
IGL02246:Plcd1 APN 9 118,901,677 (GRCm39) missense probably benign 0.16
IGL02266:Plcd1 APN 9 118,903,855 (GRCm39) splice site probably benign
IGL02270:Plcd1 APN 9 118,913,709 (GRCm39) missense probably damaging 1.00
IGL02281:Plcd1 APN 9 118,903,841 (GRCm39) missense probably benign 0.00
IGL02324:Plcd1 APN 9 118,901,710 (GRCm39) missense probably damaging 0.97
IGL02936:Plcd1 APN 9 118,903,267 (GRCm39) missense probably damaging 1.00
IGL03348:Plcd1 APN 9 118,901,558 (GRCm39) missense possibly damaging 0.91
R0366:Plcd1 UTSW 9 118,910,204 (GRCm39) missense probably damaging 0.99
R1765:Plcd1 UTSW 9 118,900,874 (GRCm39) missense probably damaging 1.00
R3704:Plcd1 UTSW 9 118,905,277 (GRCm39) missense possibly damaging 0.85
R5143:Plcd1 UTSW 9 118,903,519 (GRCm39) nonsense probably null
R5587:Plcd1 UTSW 9 118,902,900 (GRCm39) missense probably benign
R5877:Plcd1 UTSW 9 118,905,240 (GRCm39) missense probably damaging 1.00
R6043:Plcd1 UTSW 9 118,901,667 (GRCm39) missense probably damaging 1.00
R6103:Plcd1 UTSW 9 118,901,109 (GRCm39) missense probably benign 0.16
R6339:Plcd1 UTSW 9 118,904,059 (GRCm39) missense probably damaging 1.00
R6496:Plcd1 UTSW 9 118,901,709 (GRCm39) missense possibly damaging 0.79
R6516:Plcd1 UTSW 9 118,905,271 (GRCm39) missense probably damaging 0.99
R6646:Plcd1 UTSW 9 118,904,100 (GRCm39) missense probably damaging 0.99
R6854:Plcd1 UTSW 9 118,903,389 (GRCm39) splice site probably null
R6955:Plcd1 UTSW 9 118,900,924 (GRCm39) missense probably benign 0.01
R7382:Plcd1 UTSW 9 118,903,759 (GRCm39) missense probably damaging 1.00
R7577:Plcd1 UTSW 9 118,901,322 (GRCm39) missense possibly damaging 0.94
R7922:Plcd1 UTSW 9 118,903,720 (GRCm39) missense possibly damaging 0.64
R8089:Plcd1 UTSW 9 118,905,060 (GRCm39) missense possibly damaging 0.95
R9027:Plcd1 UTSW 9 118,913,709 (GRCm39) missense probably damaging 1.00
R9217:Plcd1 UTSW 9 118,901,723 (GRCm39) critical splice acceptor site probably null
R9434:Plcd1 UTSW 9 118,905,231 (GRCm39) missense probably damaging 0.99
R9596:Plcd1 UTSW 9 118,917,183 (GRCm39) missense probably benign 0.10
R9667:Plcd1 UTSW 9 118,901,698 (GRCm39) missense probably damaging 1.00
R9739:Plcd1 UTSW 9 118,901,195 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AACTAGGCTAAGACCCTCCAGG -3'
(R):5'- GATCAGGACTTCTGCTCCTC -3'

Sequencing Primer
(F):5'- TCCAGGTTCCATCCCGG -3'
(R):5'- CTCAGAGCTGCAGAGGACTG -3'
Posted On 2018-04-27