Mutagenetix > Incidental Mutations

Incidental Mutation 'R6338:Plcd1'

514335

Institutional Source

Beutler Lab

Gene Symbol

Plcd1

Ensembl Gene

ENSMUSG00000010660

Gene Name

phospholipase C, delta 1

Synonyms

PLC-delta 1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R6338 (G1)

Quality Score

191.009

Status

Not validated

Chromosome

Chromosomal Location

119071527-119093502 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 119074991 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 292 (R292C)

Ref Sequence

ENSEMBL: ENSMUSP00000149676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010804] [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000141185] [ENSMUST00000213464] [ENSMUST00000214470]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000010804
AA Change: R292C

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000010804
Gene: ENSMUSG00000010660
AA Change: R292C

Domain	Start	End	E-Value	Type
PH	22	132	9.41e-10	SMART
EFh	144	172	2.87e-2	SMART
EFh	180	208	9.34e1	SMART
Pfam:EF-hand_like	213	295	1.2e-23	PFAM
PLCXc	296	440	5.47e-94	SMART
low complexity region	461	472	N/A	INTRINSIC
PLCYc	492	609	1.22e-68	SMART
C2	630	735	1.78e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000051386

SMART Domains

Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
GEL	613	706	7.8e-16	SMART
VHP	824	859	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000074734

SMART Domains

Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
VHP	740	775	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000126251

SMART Domains

Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
Blast:GEL	1	56	9e-21	BLAST
GEL	63	149	4.38e-19	SMART
GEL	168	261	7.8e-16	SMART
VHP	357	392	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000141185

SMART Domains

Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
GEL	7	104	7.92e-17	SMART
GEL	124	210	4.38e-19	SMART
GEL	229	322	7.8e-16	SMART
VHP	440	475	2.12e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153630

Predicted Effect

probably damaging
Transcript: ENSMUST00000213464
AA Change: R292C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000214470
AA Change: R318C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214491

Meta Mutation Damage Score

0.2510

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family. Phospholipase C isozymes play critical roles in intracellular signal transduction by catalyzing the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) into the second messengers diacylglycerol (DAG) and inositol triphosphate (IP3). The encoded protein functions as a tumor suppressor in several types of cancer, and mutations in this gene are a cause of hereditary leukonychia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene show reduced body size and various abnormalities of the skin and hair including alopecia, epidermal hyperplasia, enlarged sebaceous glands, various kinds of cysts, and skin tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer3	T	C	7: 98,257,715	Y128C	probably damaging	Het
Adam30	T	G	3: 98,161,541	I102S	probably damaging	Het
Adcy8	A	T	15: 64,920,617	D163E	possibly damaging	Het
Agrn	C	T	4: 156,170,585	E1614K	probably benign	Het
Aldh16a1	A	T	7: 45,141,961	W107R	probably damaging	Het
Arfgef2	A	G	2: 166,845,570	D238G	probably damaging	Het
Arhgap11a	T	C	2: 113,833,725	S738G	probably benign	Het
Arid5b	C	A	10: 68,098,561	G504*	probably null	Het
Carmil3	T	C	14: 55,499,849	V763A	possibly damaging	Het
Cd209e	T	A	8: 3,849,154	D186V	probably damaging	Het
Cdh23	T	C	10: 60,413,151	D882G	probably damaging	Het
Cdh4	T	C	2: 179,890,812	V689A	probably damaging	Het
Cntn6	T	A	6: 104,726,139	V174E	probably damaging	Het
Col7a1	C	T	9: 108,956,633	T390M	unknown	Het
Crybg1	T	C	10: 43,992,509	D1017G	probably damaging	Het
Csmd1	T	G	8: 15,932,492	K2725T	possibly damaging	Het
Dnaaf2	T	C	12: 69,198,122	E55G	probably damaging	Het
Fam13a	A	G	6: 58,953,499	V476A	probably damaging	Het
Fem1b	A	T	9: 62,797,011	D322E	probably benign	Het
Frmpd1	G	A	4: 45,274,489	V466I	probably benign	Het
Gm11639	C	T	11: 104,843,208	R2027*	probably null	Het
Gm20671	A	T	5: 32,820,647	D1794E	probably damaging	Het
Gpatch2	G	T	1: 187,225,514	R22L	probably damaging	Het
Gtf2h1	A	G	7: 46,816,456	T450A	probably benign	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Krit1	T	G	5: 3,836,857	M702R	probably benign	Het
Krt34	T	C	11: 100,038,490	N298S	probably benign	Het
Lrrcc1	T	A	3: 14,547,316	N376K	possibly damaging	Het
Myo15	A	G	11: 60,478,133	E573G	probably damaging	Het
Olfr1224-ps1	T	A	2: 89,156,371	K268I	probably damaging	Het
Olfr1390	A	G	11: 49,340,867	S112G	probably benign	Het
Olfr366	A	T	2: 37,219,822	D111V	probably damaging	Het
Olfr391-ps	A	T	11: 73,799,319	L146Q	possibly damaging	Het
Olfr661	T	A	7: 104,688,171	V52E	possibly damaging	Het
Olfr736	T	A	14: 50,393,400	F215I	possibly damaging	Het
Phf20	A	T	2: 156,273,686	Q309L	possibly damaging	Het
Pold3	A	G	7: 100,088,105	V342A	possibly damaging	Het
Polr2a	A	T	11: 69,739,679		probably null	Het
Ptprcap	A	G	19: 4,156,224	E102G	probably benign	Het
Rab11fip5	T	C	6: 85,341,378	E843G	possibly damaging	Het
Rai14	T	C	15: 10,574,976	D632G	probably damaging	Het
Rnf149	A	T	1: 39,560,742	C268S	probably null	Het
Slc6a13	T	A	6: 121,334,839	F392I	probably damaging	Het
Slc7a11	C	T	3: 50,384,043		probably null	Het
Slf1	T	A	13: 77,084,462		probably null	Het
Stard9	G	A	2: 120,697,485	V1408I	probably benign	Het
Suclg1	T	C	6: 73,264,246	I183T	probably damaging	Het
Syne1	T	C	10: 5,255,475	E3497G	probably benign	Het
Tax1bp1	C	T	6: 52,729,376	R121*	probably null	Het
Tdpoz2	C	T	3: 93,652,336	V110I	probably benign	Het
Ubn2	A	G	6: 38,490,714	T788A	probably benign	Het
Unc13c	T	A	9: 73,734,447	I1255F	probably damaging	Het
Usp44	G	T	10: 93,846,513	R275I	probably damaging	Het
Uspl1	A	G	5: 149,215,034	N1015D	probably benign	Het
Wbp2nl	G	T	15: 82,299,045	W13C	possibly damaging	Het
Zc3h14	T	A	12: 98,758,590	D170E	possibly damaging	Het

Other mutations in Plcd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01621:Plcd1	APN	9	119076178	missense	probably damaging	1.00
IGL01634:Plcd1	APN	9	119073789	missense	probably damaging	0.99
IGL01992:Plcd1	APN	9	119075985	missense	probably benign
IGL02246:Plcd1	APN	9	119072609	missense	probably benign	0.16
IGL02266:Plcd1	APN	9	119074787	splice site	probably benign
IGL02270:Plcd1	APN	9	119084641	missense	probably damaging	1.00
IGL02281:Plcd1	APN	9	119074773	missense	probably benign	0.00
IGL02324:Plcd1	APN	9	119072642	missense	probably damaging	0.97
IGL02936:Plcd1	APN	9	119074199	missense	probably damaging	1.00
IGL03348:Plcd1	APN	9	119072490	missense	possibly damaging	0.91
R0366:Plcd1	UTSW	9	119081136	missense	probably damaging	0.99
R1765:Plcd1	UTSW	9	119071806	missense	probably damaging	1.00
R3704:Plcd1	UTSW	9	119076209	missense	possibly damaging	0.85
R5143:Plcd1	UTSW	9	119074451	nonsense	probably null
R5587:Plcd1	UTSW	9	119073832	missense	probably benign
R5877:Plcd1	UTSW	9	119076172	missense	probably damaging	1.00
R6043:Plcd1	UTSW	9	119072599	missense	probably damaging	1.00
R6103:Plcd1	UTSW	9	119072041	missense	probably benign	0.16
R6339:Plcd1	UTSW	9	119074991	missense	probably damaging	1.00
R6496:Plcd1	UTSW	9	119072641	missense	possibly damaging	0.79
R6516:Plcd1	UTSW	9	119076203	missense	probably damaging	0.99
R6646:Plcd1	UTSW	9	119075032	missense	probably damaging	0.99
R6854:Plcd1	UTSW	9	119074321	splice site	probably null
R6955:Plcd1	UTSW	9	119071856	missense	probably benign	0.01
R7382:Plcd1	UTSW	9	119074691	missense	probably damaging	1.00
R7577:Plcd1	UTSW	9	119072254	missense	possibly damaging	0.94
R7922:Plcd1	UTSW	9	119074652	missense	possibly damaging	0.64
R8089:Plcd1	UTSW	9	119075992	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AACTAGGCTAAGACCCTCCAGG -3'
(R):5'- GATCAGGACTTCTGCTCCTC -3'

Sequencing Primer
(F):5'- TCCAGGTTCCATCCCGG -3'
(R):5'- CTCAGAGCTGCAGAGGACTG -3'

Posted On

2018-04-27