Incidental Mutation 'R6338:Krt34'
ID514346
Institutional Source Beutler Lab
Gene Symbol Krt34
Ensembl Gene ENSMUSG00000043485
Gene Namekeratin 34
SynonymsKrt1-4, 4733401E01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6338 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100037347-100041554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100038490 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 298 (N298S)
Ref Sequence ENSEMBL: ENSMUSP00000056622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056362]
Predicted Effect probably benign
Transcript: ENSMUST00000056362
AA Change: N298S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000056622
Gene: ENSMUSG00000043485
AA Change: N298S

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 7.76e-151 SMART
low complexity region 378 392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Krt34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Krt34 APN 11 100038694 splice site probably benign
IGL01323:Krt34 APN 11 100038780 missense possibly damaging 0.95
IGL01403:Krt34 APN 11 100038290 missense possibly damaging 0.88
IGL01453:Krt34 APN 11 100040090 missense probably damaging 1.00
IGL02031:Krt34 APN 11 100039023 missense possibly damaging 0.95
IGL02831:Krt34 APN 11 100040147 splice site probably benign
R0024:Krt34 UTSW 11 100041037 missense probably benign 0.01
R0024:Krt34 UTSW 11 100041037 missense probably benign 0.01
R0220:Krt34 UTSW 11 100038693 splice site probably benign
R0242:Krt34 UTSW 11 100041331 missense probably damaging 1.00
R1573:Krt34 UTSW 11 100041028 missense probably benign 0.01
R1714:Krt34 UTSW 11 100040127 missense possibly damaging 0.95
R1879:Krt34 UTSW 11 100038292 missense possibly damaging 0.76
R3084:Krt34 UTSW 11 100041021 missense probably damaging 1.00
R3692:Krt34 UTSW 11 100039031 missense probably damaging 1.00
R3819:Krt34 UTSW 11 100040018 missense probably damaging 1.00
R3872:Krt34 UTSW 11 100041417 missense probably benign
R3876:Krt34 UTSW 11 100040965 missense probably benign 0.02
R6164:Krt34 UTSW 11 100038446 nonsense probably null
R6457:Krt34 UTSW 11 100040090 missense probably damaging 1.00
R7728:Krt34 UTSW 11 100039985 critical splice donor site probably null
R7748:Krt34 UTSW 11 100038938 missense probably damaging 1.00
R7903:Krt34 UTSW 11 100041495 start codon destroyed probably null 0.42
R8458:Krt34 UTSW 11 100040075 missense probably damaging 1.00
R8480:Krt34 UTSW 11 100040145 critical splice acceptor site probably null
Z1176:Krt34 UTSW 11 100041434 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTACGTGTTGATCTCACACTC -3'
(R):5'- AGCACTGCATGGTGTGTAG -3'

Sequencing Primer
(F):5'- GATCTCACACTCCAGCCTGG -3'
(R):5'- TAGTGTCCAGACCTGCTGCTG -3'
Posted On2018-04-27