Incidental Mutation 'R6338:Dnaaf2'
ID514348
Institutional Source Beutler Lab
Gene Symbol Dnaaf2
Ensembl Gene ENSMUSG00000020973
Gene Namedynein, axonemal assembly factor 2
Synonyms2810020C19Rik, kintoun, Ktu, 1110034A24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6338 (G1)
Quality Score181.009
Status Not validated
Chromosome12
Chromosomal Location69189087-69198429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69198122 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 55 (E55G)
Ref Sequence ENSEMBL: ENSMUSP00000021356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021356] [ENSMUST00000021359] [ENSMUST00000221411] [ENSMUST00000222699]
Predicted Effect probably damaging
Transcript: ENSMUST00000021356
AA Change: E55G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021356
Gene: ENSMUSG00000020973
AA Change: E55G

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:PIH1 43 352 2e-99 PFAM
low complexity region 360 373 N/A INTRINSIC
SCOP:d1keka4 398 460 4e-3 SMART
low complexity region 672 693 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021359
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181850
SMART Domains Protein: ENSMUSP00000137753
Gene: ENSMUSG00000097061

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221986
Predicted Effect probably benign
Transcript: ENSMUST00000222699
Predicted Effect probably benign
Transcript: ENSMUST00000223192
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a highly conserved protein involved in the preassembly of dynein arm complexes which power cilia. These complexes are found in some cilia and are assembled in the cytoplasm prior to transport for cilia formation. Mutations in the human gene have been associated with primary ciliary dyskinesia. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, reduced body size, situs inversus totalis, hydroencephaly and abnormal brain ependymal and tracheal cilia morphology and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Dnaaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Dnaaf2 APN 12 69196766 missense probably benign 0.23
IGL01321:Dnaaf2 APN 12 69196602 missense probably damaging 1.00
IGL01880:Dnaaf2 APN 12 69190037 missense probably benign 0.17
R0329:Dnaaf2 UTSW 12 69197744 missense probably damaging 1.00
R0330:Dnaaf2 UTSW 12 69197744 missense probably damaging 1.00
R1051:Dnaaf2 UTSW 12 69197795 missense probably damaging 1.00
R1668:Dnaaf2 UTSW 12 69196691 missense probably benign 0.04
R2011:Dnaaf2 UTSW 12 69196785 missense probably damaging 1.00
R2179:Dnaaf2 UTSW 12 69198297 unclassified probably benign
R2243:Dnaaf2 UTSW 12 69196644 missense possibly damaging 0.83
R2356:Dnaaf2 UTSW 12 69198218 missense probably benign 0.01
R4120:Dnaaf2 UTSW 12 69198038 missense possibly damaging 0.85
R5086:Dnaaf2 UTSW 12 69197286 missense probably damaging 1.00
R5205:Dnaaf2 UTSW 12 69192924 missense probably damaging 1.00
R5300:Dnaaf2 UTSW 12 69198228 missense probably damaging 0.99
R5399:Dnaaf2 UTSW 12 69196742 missense probably damaging 0.97
R5739:Dnaaf2 UTSW 12 69196941 missense probably benign
R5765:Dnaaf2 UTSW 12 69192853 missense probably damaging 1.00
R5872:Dnaaf2 UTSW 12 69197348 missense probably damaging 1.00
R6043:Dnaaf2 UTSW 12 69197348 missense probably damaging 1.00
R6503:Dnaaf2 UTSW 12 69197511 missense probably benign 0.42
R6524:Dnaaf2 UTSW 12 69190385 missense probably benign 0.43
R6895:Dnaaf2 UTSW 12 69197663 missense probably benign 0.04
R7490:Dnaaf2 UTSW 12 69197606 missense probably damaging 1.00
R7971:Dnaaf2 UTSW 12 69197345 missense probably damaging 1.00
R8209:Dnaaf2 UTSW 12 69198092 missense probably damaging 1.00
R8790:Dnaaf2 UTSW 12 69197294 missense probably damaging 1.00
Z1176:Dnaaf2 UTSW 12 69197850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTGTACTTGATCTTCAGGG -3'
(R):5'- TGATCCTTCACTGGGTCTGG -3'

Sequencing Primer
(F):5'- GGAAGACCACGTCGTAGAC -3'
(R):5'- CTTCACTGGGTCTGGGCATTG -3'
Posted On2018-04-27