Incidental Mutation 'R6338:Zc3h14'
ID 514349
Institutional Source Beutler Lab
Gene Symbol Zc3h14
Ensembl Gene ENSMUSG00000021012
Gene Name zinc finger CCCH type containing 14
Synonyms 2700069A02Rik, 1010001P15Rik, 1700016A15Rik
MMRRC Submission 044492-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 98713223-98754012 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 98724849 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 170 (D170E)
Ref Sequence ENSEMBL: ENSMUSP00000105732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057000] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532] [ENSMUST00000223083]
AlphaFold Q8BJ05
Predicted Effect possibly damaging
Transcript: ENSMUST00000057000
AA Change: D170E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012
AA Change: D170E

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 440 463 7.16e-1 SMART
ZnF_C3H1 465 484 5.27e1 SMART
ZnF_C3H1 520 542 5.55e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110104
AA Change: D170E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012
AA Change: D170E

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 465 488 7.16e-1 SMART
ZnF_C3H1 490 509 5.27e1 SMART
ZnF_C3H1 545 567 5.55e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110105
AA Change: D170E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012
AA Change: D170E

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 596 619 7.16e-1 SMART
ZnF_C3H1 621 640 5.27e1 SMART
ZnF_C3H1 676 698 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222913
Predicted Effect probably benign
Transcript: ENSMUST00000223083
Predicted Effect probably benign
Transcript: ENSMUST00000223451
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous knockout results in impaired spatial working memory, enlarged anterior lateral ventricles in the brain, small testes and reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 97,906,922 (GRCm39) Y128C probably damaging Het
Adam30 T G 3: 98,068,857 (GRCm39) I102S probably damaging Het
Adcy8 A T 15: 64,792,466 (GRCm39) D163E possibly damaging Het
Agrn C T 4: 156,255,042 (GRCm39) E1614K probably benign Het
Aldh16a1 A T 7: 44,791,385 (GRCm39) W107R probably damaging Het
Arfgef2 A G 2: 166,687,490 (GRCm39) D238G probably damaging Het
Arhgap11a T C 2: 113,664,070 (GRCm39) S738G probably benign Het
Arid5b C A 10: 67,934,391 (GRCm39) G504* probably null Het
Carmil3 T C 14: 55,737,306 (GRCm39) V763A possibly damaging Het
Cd209e T A 8: 3,899,154 (GRCm39) D186V probably damaging Het
Cdh23 T C 10: 60,248,930 (GRCm39) D882G probably damaging Het
Cdh4 T C 2: 179,532,605 (GRCm39) V689A probably damaging Het
Cntn6 T A 6: 104,703,100 (GRCm39) V174E probably damaging Het
Col7a1 C T 9: 108,785,701 (GRCm39) T390M unknown Het
Crybg1 T C 10: 43,868,505 (GRCm39) D1017G probably damaging Het
Csmd1 T G 8: 15,982,492 (GRCm39) K2725T possibly damaging Het
Dnaaf2 T C 12: 69,244,896 (GRCm39) E55G probably damaging Het
Efcab3 C T 11: 104,734,034 (GRCm39) R2027* probably null Het
Fam13a A G 6: 58,930,484 (GRCm39) V476A probably damaging Het
Fem1b A T 9: 62,704,293 (GRCm39) D322E probably benign Het
Frmpd1 G A 4: 45,274,489 (GRCm39) V466I probably benign Het
Gm20671 A T 5: 32,977,991 (GRCm39) D1794E probably damaging Het
Gpatch2 G T 1: 186,957,711 (GRCm39) R22L probably damaging Het
Gtf2h1 A G 7: 46,465,880 (GRCm39) T450A probably benign Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Krit1 T G 5: 3,886,857 (GRCm39) M702R probably benign Het
Krt34 T C 11: 99,929,316 (GRCm39) N298S probably benign Het
Lrrcc1 T A 3: 14,612,376 (GRCm39) N376K possibly damaging Het
Myo15a A G 11: 60,368,959 (GRCm39) E573G probably damaging Het
Or11j4 T A 14: 50,630,857 (GRCm39) F215I possibly damaging Het
Or1af1 A T 2: 37,109,834 (GRCm39) D111V probably damaging Het
Or1e31 A T 11: 73,690,145 (GRCm39) L146Q possibly damaging Het
Or2y17 A G 11: 49,231,694 (GRCm39) S112G probably benign Het
Or4c119 T A 2: 88,986,715 (GRCm39) K268I probably damaging Het
Or56b2 T A 7: 104,337,378 (GRCm39) V52E possibly damaging Het
Phf20 A T 2: 156,115,606 (GRCm39) Q309L possibly damaging Het
Plcd1 G A 9: 118,904,059 (GRCm39) R292C probably damaging Het
Pold3 A G 7: 99,737,312 (GRCm39) V342A possibly damaging Het
Polr2a A T 11: 69,630,505 (GRCm39) probably null Het
Ptprcap A G 19: 4,206,223 (GRCm39) E102G probably benign Het
Rab11fip5 T C 6: 85,318,360 (GRCm39) E843G possibly damaging Het
Rai14 T C 15: 10,575,062 (GRCm39) D632G probably damaging Het
Rnf149 A T 1: 39,599,823 (GRCm39) C268S probably null Het
Slc6a13 T A 6: 121,311,798 (GRCm39) F392I probably damaging Het
Slc7a11 C T 3: 50,338,492 (GRCm39) probably null Het
Slf1 T A 13: 77,232,581 (GRCm39) probably null Het
Stard9 G A 2: 120,527,966 (GRCm39) V1408I probably benign Het
Suclg1 T C 6: 73,241,229 (GRCm39) I183T probably damaging Het
Syne1 T C 10: 5,205,475 (GRCm39) E3497G probably benign Het
Tax1bp1 C T 6: 52,706,361 (GRCm39) R121* probably null Het
Tdpoz2 C T 3: 93,559,643 (GRCm39) V110I probably benign Het
Ubn2 A G 6: 38,467,649 (GRCm39) T788A probably benign Het
Unc13c T A 9: 73,641,729 (GRCm39) I1255F probably damaging Het
Usp44 G T 10: 93,682,375 (GRCm39) R275I probably damaging Het
Uspl1 A G 5: 149,151,844 (GRCm39) N1015D probably benign Het
Wbp2nl G T 15: 82,183,246 (GRCm39) W13C possibly damaging Het
Other mutations in Zc3h14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Zc3h14 APN 12 98,713,783 (GRCm39) critical splice donor site probably null
IGL00946:Zc3h14 APN 12 98,726,142 (GRCm39) splice site probably benign
IGL00969:Zc3h14 APN 12 98,725,102 (GRCm39) missense probably benign 0.00
IGL01626:Zc3h14 APN 12 98,745,445 (GRCm39) missense possibly damaging 0.72
IGL01891:Zc3h14 APN 12 98,725,206 (GRCm39) unclassified probably benign
IGL02119:Zc3h14 APN 12 98,730,154 (GRCm39) missense probably benign 0.00
IGL02484:Zc3h14 APN 12 98,740,560 (GRCm39) missense probably benign 0.14
IGL02744:Zc3h14 APN 12 98,751,234 (GRCm39) missense possibly damaging 0.67
IGL02894:Zc3h14 APN 12 98,725,202 (GRCm39) critical splice donor site probably null
R0408:Zc3h14 UTSW 12 98,730,082 (GRCm39) missense probably damaging 1.00
R0739:Zc3h14 UTSW 12 98,723,460 (GRCm39) missense probably damaging 0.99
R0865:Zc3h14 UTSW 12 98,745,528 (GRCm39) critical splice donor site probably null
R0926:Zc3h14 UTSW 12 98,724,849 (GRCm39) missense possibly damaging 0.94
R1530:Zc3h14 UTSW 12 98,751,262 (GRCm39) missense probably damaging 1.00
R1735:Zc3h14 UTSW 12 98,724,839 (GRCm39) missense probably damaging 1.00
R1743:Zc3h14 UTSW 12 98,745,448 (GRCm39) missense probably benign 0.04
R1848:Zc3h14 UTSW 12 98,719,091 (GRCm39) missense possibly damaging 0.89
R1851:Zc3h14 UTSW 12 98,726,613 (GRCm39) nonsense probably null
R1978:Zc3h14 UTSW 12 98,730,181 (GRCm39) missense probably damaging 0.97
R2011:Zc3h14 UTSW 12 98,746,527 (GRCm39) missense possibly damaging 0.76
R2198:Zc3h14 UTSW 12 98,719,069 (GRCm39) missense possibly damaging 0.94
R2198:Zc3h14 UTSW 12 98,719,068 (GRCm39) missense probably damaging 1.00
R2263:Zc3h14 UTSW 12 98,724,773 (GRCm39) missense probably benign 0.32
R3762:Zc3h14 UTSW 12 98,724,902 (GRCm39) missense probably damaging 1.00
R4210:Zc3h14 UTSW 12 98,751,658 (GRCm39) missense probably damaging 1.00
R4353:Zc3h14 UTSW 12 98,730,219 (GRCm39) missense possibly damaging 0.70
R4360:Zc3h14 UTSW 12 98,746,456 (GRCm39) missense probably benign 0.09
R4814:Zc3h14 UTSW 12 98,719,107 (GRCm39) missense probably damaging 1.00
R4815:Zc3h14 UTSW 12 98,719,107 (GRCm39) missense probably damaging 1.00
R4817:Zc3h14 UTSW 12 98,719,107 (GRCm39) missense probably damaging 1.00
R4947:Zc3h14 UTSW 12 98,726,083 (GRCm39) missense probably benign
R5077:Zc3h14 UTSW 12 98,723,465 (GRCm39) critical splice donor site probably null
R5431:Zc3h14 UTSW 12 98,746,324 (GRCm39) missense possibly damaging 0.94
R5783:Zc3h14 UTSW 12 98,723,434 (GRCm39) missense probably damaging 0.99
R5850:Zc3h14 UTSW 12 98,745,414 (GRCm39) missense probably damaging 0.97
R6034:Zc3h14 UTSW 12 98,737,632 (GRCm39) missense probably benign 0.01
R6034:Zc3h14 UTSW 12 98,737,632 (GRCm39) missense probably benign 0.01
R6291:Zc3h14 UTSW 12 98,726,087 (GRCm39) missense probably damaging 1.00
R6595:Zc3h14 UTSW 12 98,723,285 (GRCm39) missense probably damaging 0.98
R6737:Zc3h14 UTSW 12 98,751,305 (GRCm39) missense probably damaging 1.00
R6932:Zc3h14 UTSW 12 98,737,336 (GRCm39) intron probably benign
R7074:Zc3h14 UTSW 12 98,724,859 (GRCm39) missense possibly damaging 0.96
R7204:Zc3h14 UTSW 12 98,737,615 (GRCm39) missense probably damaging 1.00
R7237:Zc3h14 UTSW 12 98,746,408 (GRCm39) missense probably benign 0.34
R7267:Zc3h14 UTSW 12 98,751,988 (GRCm39) missense probably damaging 1.00
R8753:Zc3h14 UTSW 12 98,724,831 (GRCm39) missense probably benign 0.12
R9169:Zc3h14 UTSW 12 98,745,505 (GRCm39) missense probably damaging 1.00
R9610:Zc3h14 UTSW 12 98,737,663 (GRCm39) missense possibly damaging 0.92
RF020:Zc3h14 UTSW 12 98,746,541 (GRCm39) critical splice donor site probably null
RF024:Zc3h14 UTSW 12 98,725,120 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAATGACTATTTGAAAGGCCTCC -3'
(R):5'- GGATGAAGTTGCAGCCTGTTTAAG -3'

Sequencing Primer
(F):5'- GACTATTTGAAAGGCCTCCATACTAC -3'
(R):5'- CAGCCTGTTTAAGTGAGTACCAG -3'
Posted On 2018-04-27