Mutagenetix > Incidental Mutations

Incidental Mutation 'R6338:Slf1'

514350

Institutional Source

Beutler Lab

Gene Symbol

Slf1

Ensembl Gene

ENSMUSG00000021597

Gene Name

SMC5-SMC6 complex localization factor 1

Synonyms

2700017A04Rik, Brctx, Brctd1, C730024G01Rik, Ankrd32

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6338 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

77043088-77135473 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 77084462 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000151524] [ENSMUST00000151524]

Predicted Effect

probably null
Transcript: ENSMUST00000151524

SMART Domains

Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597

Domain	Start	End	E-Value	Type
BRCT	2	80	1.37e-2	SMART
BRCT	121	199	2.12e1	SMART
low complexity region	260	273	N/A	INTRINSIC
low complexity region	527	541	N/A	INTRINSIC
low complexity region	765	785	N/A	INTRINSIC
ANK	802	832	1.52e0	SMART
ANK	836	865	4.32e-5	SMART
ANK	870	900	2.07e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000151524

SMART Domains

Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597

Domain	Start	End	E-Value	Type
BRCT	2	80	1.37e-2	SMART
BRCT	121	199	2.12e1	SMART
low complexity region	260	273	N/A	INTRINSIC
low complexity region	527	541	N/A	INTRINSIC
low complexity region	765	785	N/A	INTRINSIC
ANK	802	832	1.52e0	SMART
ANK	836	865	4.32e-5	SMART
ANK	870	900	2.07e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are developmentally normal and fertile with no pathological abnormalities or defects in T-cell development and genomic stability. Mutant MEFs grow at a normal rate and are not more sensitive to DNA-damaging agents while thymocytes donot show any major cell cycle defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer3	T	C	7: 98,257,715	Y128C	probably damaging	Het
Adam30	T	G	3: 98,161,541	I102S	probably damaging	Het
Adcy8	A	T	15: 64,920,617	D163E	possibly damaging	Het
Agrn	C	T	4: 156,170,585	E1614K	probably benign	Het
Aldh16a1	A	T	7: 45,141,961	W107R	probably damaging	Het
Arfgef2	A	G	2: 166,845,570	D238G	probably damaging	Het
Arhgap11a	T	C	2: 113,833,725	S738G	probably benign	Het
Arid5b	C	A	10: 68,098,561	G504*	probably null	Het
Carmil3	T	C	14: 55,499,849	V763A	possibly damaging	Het
Cd209e	T	A	8: 3,849,154	D186V	probably damaging	Het
Cdh23	T	C	10: 60,413,151	D882G	probably damaging	Het
Cdh4	T	C	2: 179,890,812	V689A	probably damaging	Het
Cntn6	T	A	6: 104,726,139	V174E	probably damaging	Het
Col7a1	C	T	9: 108,956,633	T390M	unknown	Het
Crybg1	T	C	10: 43,992,509	D1017G	probably damaging	Het
Csmd1	T	G	8: 15,932,492	K2725T	possibly damaging	Het
Dnaaf2	T	C	12: 69,198,122	E55G	probably damaging	Het
Fam13a	A	G	6: 58,953,499	V476A	probably damaging	Het
Fem1b	A	T	9: 62,797,011	D322E	probably benign	Het
Frmpd1	G	A	4: 45,274,489	V466I	probably benign	Het
Gm11639	C	T	11: 104,843,208	R2027*	probably null	Het
Gm20671	A	T	5: 32,820,647	D1794E	probably damaging	Het
Gpatch2	G	T	1: 187,225,514	R22L	probably damaging	Het
Gtf2h1	A	G	7: 46,816,456	T450A	probably benign	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Krit1	T	G	5: 3,836,857	M702R	probably benign	Het
Krt34	T	C	11: 100,038,490	N298S	probably benign	Het
Lrrcc1	T	A	3: 14,547,316	N376K	possibly damaging	Het
Myo15	A	G	11: 60,478,133	E573G	probably damaging	Het
Olfr1224-ps1	T	A	2: 89,156,371	K268I	probably damaging	Het
Olfr1390	A	G	11: 49,340,867	S112G	probably benign	Het
Olfr366	A	T	2: 37,219,822	D111V	probably damaging	Het
Olfr391-ps	A	T	11: 73,799,319	L146Q	possibly damaging	Het
Olfr661	T	A	7: 104,688,171	V52E	possibly damaging	Het
Olfr736	T	A	14: 50,393,400	F215I	possibly damaging	Het
Phf20	A	T	2: 156,273,686	Q309L	possibly damaging	Het
Plcd1	G	A	9: 119,074,991	R292C	probably damaging	Het
Pold3	A	G	7: 100,088,105	V342A	possibly damaging	Het
Polr2a	A	T	11: 69,739,679		probably null	Het
Ptprcap	A	G	19: 4,156,224	E102G	probably benign	Het
Rab11fip5	T	C	6: 85,341,378	E843G	possibly damaging	Het
Rai14	T	C	15: 10,574,976	D632G	probably damaging	Het
Rnf149	A	T	1: 39,560,742	C268S	probably null	Het
Slc6a13	T	A	6: 121,334,839	F392I	probably damaging	Het
Slc7a11	C	T	3: 50,384,043		probably null	Het
Stard9	G	A	2: 120,697,485	V1408I	probably benign	Het
Suclg1	T	C	6: 73,264,246	I183T	probably damaging	Het
Syne1	T	C	10: 5,255,475	E3497G	probably benign	Het
Tax1bp1	C	T	6: 52,729,376	R121*	probably null	Het
Tdpoz2	C	T	3: 93,652,336	V110I	probably benign	Het
Ubn2	A	G	6: 38,490,714	T788A	probably benign	Het
Unc13c	T	A	9: 73,734,447	I1255F	probably damaging	Het
Usp44	G	T	10: 93,846,513	R275I	probably damaging	Het
Uspl1	A	G	5: 149,215,034	N1015D	probably benign	Het
Wbp2nl	G	T	15: 82,299,045	W13C	possibly damaging	Het
Zc3h14	T	A	12: 98,758,590	D170E	possibly damaging	Het

Other mutations in Slf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00942:Slf1	APN	13	77043947	missense	possibly damaging	0.95
IGL01105:Slf1	APN	13	77100912	unclassified	probably benign
IGL01108:Slf1	APN	13	77125475	splice site	probably benign
IGL01149:Slf1	APN	13	77112648	missense	probably damaging	0.99
IGL01642:Slf1	APN	13	77049915	missense	probably benign	0.00
IGL01757:Slf1	APN	13	77084440	missense	probably benign
IGL01887:Slf1	APN	13	77100982	missense	probably benign	0.02
IGL02323:Slf1	APN	13	77051294	missense	possibly damaging	0.87
IGL02861:Slf1	APN	13	77126359	splice site	probably benign
IGL02971:Slf1	APN	13	77047104	splice site	probably benign
IGL03088:Slf1	APN	13	77084435	missense	probably damaging	1.00
IGL03215:Slf1	APN	13	77049977	missense	probably benign	0.00
IGL02980:Slf1	UTSW	13	77044004	missense	possibly damaging	0.92
PIT1430001:Slf1	UTSW	13	77050050	splice site	probably benign
R0036:Slf1	UTSW	13	77100951	missense	probably benign	0.02
R0036:Slf1	UTSW	13	77100951	missense	probably benign	0.02
R0125:Slf1	UTSW	13	77043745	missense	probably benign	0.02
R0230:Slf1	UTSW	13	77112748	intron	probably benign
R0244:Slf1	UTSW	13	77126632	nonsense	probably null
R0395:Slf1	UTSW	13	77105969	splice site	probably benign
R0614:Slf1	UTSW	13	77049114	missense	probably benign	0.10
R0661:Slf1	UTSW	13	77083596	missense	probably benign	0.31
R0837:Slf1	UTSW	13	77100948	splice site	probably null
R0945:Slf1	UTSW	13	77103471	unclassified	probably benign
R1282:Slf1	UTSW	13	77043840	missense	probably damaging	0.97
R1365:Slf1	UTSW	13	77126371	missense	probably damaging	1.00
R1449:Slf1	UTSW	13	77083449	missense	probably damaging	1.00
R1646:Slf1	UTSW	13	77066648	nonsense	probably null
R2071:Slf1	UTSW	13	77104624	missense	probably benign	0.02
R2141:Slf1	UTSW	13	77049219	critical splice acceptor site	probably null
R2217:Slf1	UTSW	13	77046706	critical splice acceptor site	probably null
R2397:Slf1	UTSW	13	77103583	nonsense	probably null
R2520:Slf1	UTSW	13	77051265	missense	probably damaging	1.00
R3108:Slf1	UTSW	13	77126721	splice site	probably benign
R4178:Slf1	UTSW	13	77043569	missense	probably damaging	1.00
R4663:Slf1	UTSW	13	77126604	missense	probably damaging	1.00
R4730:Slf1	UTSW	13	77046632	missense	probably damaging	1.00
R4910:Slf1	UTSW	13	77043880	missense	probably benign	0.14
R4912:Slf1	UTSW	13	77051294	missense	probably damaging	1.00
R5122:Slf1	UTSW	13	77049987	missense	probably benign	0.01
R5269:Slf1	UTSW	13	77104581	missense	probably benign	0.33
R5336:Slf1	UTSW	13	77106010	makesense	probably null
R5346:Slf1	UTSW	13	77092371	missense	probably benign	0.00
R5445:Slf1	UTSW	13	77091204	missense	probably benign	0.10
R5568:Slf1	UTSW	13	77046704	missense	probably damaging	1.00
R5622:Slf1	UTSW	13	77049971	missense	probably benign	0.14
R5685:Slf1	UTSW	13	77083479	missense	possibly damaging	0.88
R5792:Slf1	UTSW	13	77066737	missense	probably benign	0.03
R5856:Slf1	UTSW	13	77106087	missense	possibly damaging	0.63
R6109:Slf1	UTSW	13	77126680	missense	probably damaging	0.99
R6245:Slf1	UTSW	13	77084383	missense	probably damaging	1.00
R6438:Slf1	UTSW	13	77066606	missense	probably damaging	1.00
R6487:Slf1	UTSW	13	77066617	missense	probably damaging	1.00
R6597:Slf1	UTSW	13	77049129	missense	probably benign	0.01
R6600:Slf1	UTSW	13	77083536	missense	probably benign	0.00
R6661:Slf1	UTSW	13	77043845	missense	probably damaging	1.00
R7268:Slf1	UTSW	13	77066707	missense	probably damaging	1.00
R7308:Slf1	UTSW	13	77051168	missense	probably benign	0.19
R7355:Slf1	UTSW	13	77091303	missense	probably damaging	1.00
R7546:Slf1	UTSW	13	77049192	missense	probably benign
R7807:Slf1	UTSW	13	77046704	missense	probably damaging	1.00
R8175:Slf1	UTSW	13	77112671	missense	probably damaging	1.00
R8385:Slf1	UTSW	13	77105990	missense	probably benign
R8698:Slf1	UTSW	13	77049165	missense	possibly damaging	0.78
R8770:Slf1	UTSW	13	77046647	missense	probably damaging	1.00
R8786:Slf1	UTSW	13	77126687	missense	possibly damaging	0.93
R8796:Slf1	UTSW	13	77066665	missense	probably benign	0.00
X0018:Slf1	UTSW	13	77051238	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCAAAACTTCACTGCCATTAGATTG -3'
(R):5'- AGGGGACTTTTGGGAAAGCATTTC -3'

Sequencing Primer
(F):5'- CTTCACTGCCATTAGATTGTGTATG -3'
(R):5'- GGACTTTTGGGAAAGCATTTCAAATG -3'

Posted On

2018-04-27