Mutagenetix > Incidental Mutation

Incidental Mutation 'R6338:Rai14'

514353

Institutional Source

Beutler Lab

Gene Symbol

Rai14

Ensembl Gene

ENSMUSG00000022246

Gene Name

retinoic acid induced 14

Synonyms

1700008J19Rik, 1700020L11Rik, Ankycorbin, Norpeg

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.515) question?

Stock #

R6338 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

10568969-10714624 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10574976 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 632 (D632G)

Ref Sequence

ENSEMBL: ENSMUSP00000153969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]

AlphaFold

Q9EP71

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090339
AA Change: D661G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: D661G

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169385
AA Change: D661G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: D661G

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000227506
AA Change: D632G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer3	T	C	7: 98,257,715	Y128C	probably damaging	Het
Adam30	T	G	3: 98,161,541	I102S	probably damaging	Het
Adcy8	A	T	15: 64,920,617	D163E	possibly damaging	Het
Agrn	C	T	4: 156,170,585	E1614K	probably benign	Het
Aldh16a1	A	T	7: 45,141,961	W107R	probably damaging	Het
Arfgef2	A	G	2: 166,845,570	D238G	probably damaging	Het
Arhgap11a	T	C	2: 113,833,725	S738G	probably benign	Het
Arid5b	C	A	10: 68,098,561	G504*	probably null	Het
Carmil3	T	C	14: 55,499,849	V763A	possibly damaging	Het
Cd209e	T	A	8: 3,849,154	D186V	probably damaging	Het
Cdh23	T	C	10: 60,413,151	D882G	probably damaging	Het
Cdh4	T	C	2: 179,890,812	V689A	probably damaging	Het
Cntn6	T	A	6: 104,726,139	V174E	probably damaging	Het
Col7a1	C	T	9: 108,956,633	T390M	unknown	Het
Crybg1	T	C	10: 43,992,509	D1017G	probably damaging	Het
Csmd1	T	G	8: 15,932,492	K2725T	possibly damaging	Het
Dnaaf2	T	C	12: 69,198,122	E55G	probably damaging	Het
Fam13a	A	G	6: 58,953,499	V476A	probably damaging	Het
Fem1b	A	T	9: 62,797,011	D322E	probably benign	Het
Frmpd1	G	A	4: 45,274,489	V466I	probably benign	Het
Gm11639	C	T	11: 104,843,208	R2027*	probably null	Het
Gm20671	A	T	5: 32,820,647	D1794E	probably damaging	Het
Gpatch2	G	T	1: 187,225,514	R22L	probably damaging	Het
Gtf2h1	A	G	7: 46,816,456	T450A	probably benign	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Krit1	T	G	5: 3,836,857	M702R	probably benign	Het
Krt34	T	C	11: 100,038,490	N298S	probably benign	Het
Lrrcc1	T	A	3: 14,547,316	N376K	possibly damaging	Het
Myo15	A	G	11: 60,478,133	E573G	probably damaging	Het
Olfr1224-ps1	T	A	2: 89,156,371	K268I	probably damaging	Het
Olfr1390	A	G	11: 49,340,867	S112G	probably benign	Het
Olfr366	A	T	2: 37,219,822	D111V	probably damaging	Het
Olfr391-ps	A	T	11: 73,799,319	L146Q	possibly damaging	Het
Olfr661	T	A	7: 104,688,171	V52E	possibly damaging	Het
Olfr736	T	A	14: 50,393,400	F215I	possibly damaging	Het
Phf20	A	T	2: 156,273,686	Q309L	possibly damaging	Het
Plcd1	G	A	9: 119,074,991	R292C	probably damaging	Het
Pold3	A	G	7: 100,088,105	V342A	possibly damaging	Het
Polr2a	A	T	11: 69,739,679		probably null	Het
Ptprcap	A	G	19: 4,156,224	E102G	probably benign	Het
Rab11fip5	T	C	6: 85,341,378	E843G	possibly damaging	Het
Rnf149	A	T	1: 39,560,742	C268S	probably null	Het
Slc6a13	T	A	6: 121,334,839	F392I	probably damaging	Het
Slc7a11	C	T	3: 50,384,043		probably null	Het
Slf1	T	A	13: 77,084,462		probably null	Het
Stard9	G	A	2: 120,697,485	V1408I	probably benign	Het
Suclg1	T	C	6: 73,264,246	I183T	probably damaging	Het
Syne1	T	C	10: 5,255,475	E3497G	probably benign	Het
Tax1bp1	C	T	6: 52,729,376	R121*	probably null	Het
Tdpoz2	C	T	3: 93,652,336	V110I	probably benign	Het
Ubn2	A	G	6: 38,490,714	T788A	probably benign	Het
Unc13c	T	A	9: 73,734,447	I1255F	probably damaging	Het
Usp44	G	T	10: 93,846,513	R275I	probably damaging	Het
Uspl1	A	G	5: 149,215,034	N1015D	probably benign	Het
Wbp2nl	G	T	15: 82,299,045	W13C	possibly damaging	Het
Zc3h14	T	A	12: 98,758,590	D170E	possibly damaging	Het

Other mutations in Rai14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Rai14	APN	15	10599711	splice site	probably benign
IGL01625:Rai14	APN	15	10572374	missense	probably benign	0.30
IGL01925:Rai14	APN	15	10595862	missense	possibly damaging	0.88
IGL02053:Rai14	APN	15	10633156	missense	probably benign	0.00
IGL02531:Rai14	APN	15	10574782	missense	probably damaging	1.00
IGL02748:Rai14	APN	15	10589335	missense	probably benign	0.14
IGL02945:Rai14	APN	15	10574709	missense	probably benign	0.00
PIT4618001:Rai14	UTSW	15	10575156	missense	probably damaging	1.00
R1400:Rai14	UTSW	15	10571548	missense	probably damaging	0.98
R1583:Rai14	UTSW	15	10587916	missense	probably damaging	1.00
R1686:Rai14	UTSW	15	10592196	missense	probably damaging	0.98
R1721:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1867:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1868:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1998:Rai14	UTSW	15	10594981	splice site	probably null
R2118:Rai14	UTSW	15	10575166	missense	probably benign	0.00
R3161:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R4049:Rai14	UTSW	15	10592212	missense	probably benign	0.30
R4611:Rai14	UTSW	15	10592138	missense	probably damaging	1.00
R4760:Rai14	UTSW	15	10575690	missense	possibly damaging	0.60
R4863:Rai14	UTSW	15	10572470	missense	probably damaging	0.99
R5022:Rai14	UTSW	15	10574506	missense	probably damaging	0.96
R5110:Rai14	UTSW	15	10690410	start gained	probably benign
R5410:Rai14	UTSW	15	10574938	missense	probably damaging	1.00
R5643:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5644:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5681:Rai14	UTSW	15	10575120	missense	probably damaging	1.00
R5934:Rai14	UTSW	15	10575159	missense	probably damaging	0.98
R6333:Rai14	UTSW	15	10574936	nonsense	probably null
R6864:Rai14	UTSW	15	10633168	missense	possibly damaging	0.95
R7015:Rai14	UTSW	15	10589315	nonsense	probably null
R7155:Rai14	UTSW	15	10595003	missense	possibly damaging	0.53
R7480:Rai14	UTSW	15	10571536	missense	probably benign	0.02
R7574:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7578:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7578:Rai14	UTSW	15	10574828	missense	probably benign
R7597:Rai14	UTSW	15	10574851	missense	possibly damaging	0.94
R7658:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7779:Rai14	UTSW	15	10593026	missense	probably damaging	1.00
R7946:Rai14	UTSW	15	10574201	splice site	probably null
R8171:Rai14	UTSW	15	10633163	missense	probably damaging	1.00
R8195:Rai14	UTSW	15	10575216	missense	probably benign
R8471:Rai14	UTSW	15	10575159	missense	probably benign	0.01
R8485:Rai14	UTSW	15	10575036	missense	probably damaging	1.00
R9075:Rai14	UTSW	15	10589317	missense	probably damaging	1.00
R9287:Rai14	UTSW	15	10592118	missense	probably benign	0.14
R9502:Rai14	UTSW	15	10587861	missense	possibly damaging	0.50
R9603:Rai14	UTSW	15	10595030	nonsense	probably null
R9665:Rai14	UTSW	15	10574717	missense	probably damaging	1.00
R9767:Rai14	UTSW	15	10610041	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCAAATGCTCTGTGATGGAC -3'
(R):5'- TTGAGAAATATCAACAGGCCCAAG -3'

Sequencing Primer
(F):5'- GTGCATCCACCAGCTGTTTGAG -3'
(R):5'- TCAACAGGCCCAAGAAGAGATCATG -3'

Posted On

2018-04-27