Incidental Mutation 'R6341:Wdr75'
ID 514360
Institutional Source Beutler Lab
Gene Symbol Wdr75
Ensembl Gene ENSMUSG00000025995
Gene Name WD repeat domain 75
Synonyms 2410118I19Rik, 1300003A18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock # R6341 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 45795166-45823619 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 45802131 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027139] [ENSMUST00000147308]
AlphaFold Q3U821
Predicted Effect probably null
Transcript: ENSMUST00000027139
SMART Domains Protein: ENSMUSP00000027139
Gene: ENSMUSG00000025995

DomainStartEndE-ValueType
WD40 4 42 3.82e1 SMART
WD40 45 85 1.25e-9 SMART
WD40 185 230 1.61e-3 SMART
WD40 239 275 4.44e0 SMART
WD40 278 317 7.67e0 SMART
low complexity region 405 417 N/A INTRINSIC
WD40 431 473 7.67e0 SMART
WD40 486 524 3.08e0 SMART
WD40 527 568 3.96e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146602
Predicted Effect probably null
Transcript: ENSMUST00000147308
SMART Domains Protein: ENSMUSP00000117363
Gene: ENSMUSG00000025995

DomainStartEndE-ValueType
WD40 4 42 3.82e1 SMART
WD40 45 85 1.25e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154436
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Wdr75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Wdr75 APN 1 45802075 missense probably benign 0.02
IGL00711:Wdr75 APN 1 45823381 missense probably benign 0.00
IGL01350:Wdr75 APN 1 45818260 nonsense probably null
IGL02135:Wdr75 APN 1 45814563 missense probably damaging 1.00
IGL02135:Wdr75 APN 1 45817448 splice site probably null
BB008:Wdr75 UTSW 1 45819635 missense probably benign 0.00
BB018:Wdr75 UTSW 1 45819635 missense probably benign 0.00
FR4976:Wdr75 UTSW 1 45823404 utr 3 prime probably benign
PIT4378001:Wdr75 UTSW 1 45820173 missense probably damaging 0.98
R0060:Wdr75 UTSW 1 45816617 missense probably benign 0.16
R0463:Wdr75 UTSW 1 45819602 missense probably damaging 1.00
R0963:Wdr75 UTSW 1 45817310 missense probably benign 0.07
R1364:Wdr75 UTSW 1 45799062 missense probably benign 0.01
R1382:Wdr75 UTSW 1 45817311 missense probably damaging 1.00
R1562:Wdr75 UTSW 1 45803870 splice site probably null
R1909:Wdr75 UTSW 1 45823403 missense probably benign 0.00
R2968:Wdr75 UTSW 1 45817341 missense probably damaging 1.00
R3972:Wdr75 UTSW 1 45822554 missense probably benign 0.01
R4372:Wdr75 UTSW 1 45806673 unclassified probably benign
R4720:Wdr75 UTSW 1 45822485 missense probably benign 0.05
R4922:Wdr75 UTSW 1 45816478 missense probably damaging 1.00
R5201:Wdr75 UTSW 1 45823359 missense probably benign 0.00
R5242:Wdr75 UTSW 1 45817327 nonsense probably null
R5255:Wdr75 UTSW 1 45799117 missense probably damaging 1.00
R5320:Wdr75 UTSW 1 45799051 missense probably damaging 0.96
R5450:Wdr75 UTSW 1 45812164 missense probably benign 0.26
R6072:Wdr75 UTSW 1 45799051 missense probably damaging 0.96
R6147:Wdr75 UTSW 1 45819538 missense probably benign 0.00
R6629:Wdr75 UTSW 1 45812056 missense probably damaging 1.00
R6646:Wdr75 UTSW 1 45799087 missense probably damaging 1.00
R6722:Wdr75 UTSW 1 45805352 splice site probably null
R6750:Wdr75 UTSW 1 45817379 missense probably damaging 1.00
R6850:Wdr75 UTSW 1 45814598 missense probably benign 0.00
R6851:Wdr75 UTSW 1 45823427 missense probably benign
R7172:Wdr75 UTSW 1 45799134 missense probably damaging 1.00
R7248:Wdr75 UTSW 1 45817400 missense probably damaging 1.00
R7809:Wdr75 UTSW 1 45823436 missense probably benign 0.00
R7931:Wdr75 UTSW 1 45819635 missense probably benign 0.00
R7937:Wdr75 UTSW 1 45819639 missense probably benign 0.17
R8171:Wdr75 UTSW 1 45822546 missense probably benign 0.00
R8218:Wdr75 UTSW 1 45818182 missense probably damaging 1.00
R8724:Wdr75 UTSW 1 45817400 missense probably damaging 1.00
R8900:Wdr75 UTSW 1 45799127 missense probably damaging 0.99
R9400:Wdr75 UTSW 1 45803904 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGTCCTTAAATTGCACCATGAG -3'
(R):5'- CCTTGCCTGGATTTAACACAG -3'

Sequencing Primer
(F):5'- AATTGCACCATGAGTTCTGTG -3'
(R):5'- TAGTGTCGAGACCCTTGT -3'
Posted On 2018-04-27