Incidental Mutation 'R6341:Srgap2'
ID514363
Institutional Source Beutler Lab
Gene Symbol Srgap2
Ensembl Gene ENSMUSG00000026425
Gene NameSLIT-ROBO Rho GTPase activating protein 2
SynonymsFBP2, Fnbp2, 9930124L22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6341 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location131285251-131527352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131291629 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 259 (R259H)
Ref Sequence ENSEMBL: ENSMUSP00000140927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097588] [ENSMUST00000186543] [ENSMUST00000187042]
Predicted Effect probably benign
Transcript: ENSMUST00000097588
SMART Domains Protein: ENSMUSP00000095195
Gene: ENSMUSG00000026425

DomainStartEndE-ValueType
FCH 22 120 7.33e-18 SMART
low complexity region 178 191 N/A INTRINSIC
coiled coil region 363 401 N/A INTRINSIC
Blast:RhoGAP 445 490 7e-12 BLAST
RhoGAP 502 676 9.6e-60 SMART
SH3 731 786 4.52e-15 SMART
low complexity region 852 868 N/A INTRINSIC
coiled coil region 940 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186543
SMART Domains Protein: ENSMUSP00000139405
Gene: ENSMUSG00000026425

DomainStartEndE-ValueType
FCH 22 120 3.7e-20 SMART
low complexity region 178 191 N/A INTRINSIC
coiled coil region 363 401 N/A INTRINSIC
Blast:RhoGAP 445 490 7e-12 BLAST
RhoGAP 502 676 5.9e-62 SMART
SH3 731 786 2.8e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187042
AA Change: R259H

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140927
Gene: ENSMUSG00000026425
AA Change: R259H

DomainStartEndE-ValueType
SH3 25 80 2.8e-17 SMART
low complexity region 146 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188604
Predicted Effect probably benign
Transcript: ENSMUST00000188770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190336
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the SLIT-ROBO Rho GTPase activating protein family. The encoded protein stimulates GTPase activity of Rac1, and plays a role in cortical neuron development. This locus has several paralogs on human chromosome 1 resulting from segmental duplication. While this locus itself is conserved among various species, the paralogs are found only in the genus Homo, and not in the genomes of non-human great apes. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are born at below the expected Mendelian ratio, but are otherwise viable. Layer 5 cortical pyramidal neurons exhibit an increased density of dendritic spines with a decreased spine head width and increased length of spine necks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Srgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Srgap2 APN 1 131356700 missense possibly damaging 0.89
IGL01738:Srgap2 APN 1 131296426 missense probably benign 0.00
IGL01933:Srgap2 APN 1 131411855 missense probably damaging 1.00
IGL01964:Srgap2 APN 1 131289578 missense probably benign 0.08
IGL02028:Srgap2 APN 1 131296435 missense probably damaging 0.98
IGL02159:Srgap2 APN 1 131319666 splice site probably benign
IGL02326:Srgap2 APN 1 131356907 critical splice acceptor site probably null
IGL02396:Srgap2 APN 1 131292675 missense probably damaging 0.99
IGL02407:Srgap2 APN 1 131319602 missense probably damaging 1.00
IGL02444:Srgap2 APN 1 131325153 splice site probably null
IGL02559:Srgap2 APN 1 131524936 critical splice donor site probably null
IGL02900:Srgap2 APN 1 131411796 splice site probably benign
IGL03150:Srgap2 APN 1 131310600 missense probably damaging 1.00
R0008:Srgap2 UTSW 1 131355564 missense probably damaging 0.99
R0008:Srgap2 UTSW 1 131355564 missense probably damaging 0.99
R0016:Srgap2 UTSW 1 131349462 missense possibly damaging 0.95
R0016:Srgap2 UTSW 1 131349462 missense possibly damaging 0.95
R0044:Srgap2 UTSW 1 131319551 missense possibly damaging 0.68
R0441:Srgap2 UTSW 1 131336437 missense probably damaging 1.00
R0580:Srgap2 UTSW 1 131349501 missense possibly damaging 0.81
R0882:Srgap2 UTSW 1 131289515 missense probably benign 0.00
R1412:Srgap2 UTSW 1 131300413 missense possibly damaging 0.81
R1501:Srgap2 UTSW 1 131292699 missense probably damaging 1.00
R1740:Srgap2 UTSW 1 131289388 missense probably benign 0.00
R1764:Srgap2 UTSW 1 131319537 missense possibly damaging 0.94
R1772:Srgap2 UTSW 1 131319638 missense probably damaging 0.99
R1776:Srgap2 UTSW 1 131411850 missense probably damaging 1.00
R2393:Srgap2 UTSW 1 131332134 missense probably benign 0.00
R3011:Srgap2 UTSW 1 131310591 missense probably damaging 0.99
R3149:Srgap2 UTSW 1 131292589 missense probably benign 0.00
R3150:Srgap2 UTSW 1 131292589 missense probably benign 0.00
R3800:Srgap2 UTSW 1 131310559 missense probably damaging 1.00
R4871:Srgap2 UTSW 1 131289472 missense probably benign 0.00
R4884:Srgap2 UTSW 1 131292576 splice site probably null
R5454:Srgap2 UTSW 1 131289737 missense probably benign 0.08
R5536:Srgap2 UTSW 1 131300390 splice site probably null
R6113:Srgap2 UTSW 1 131355505 splice site probably null
R6174:Srgap2 UTSW 1 131289616 missense probably benign 0.00
R6180:Srgap2 UTSW 1 131349541 missense probably benign 0.00
R6357:Srgap2 UTSW 1 131355542 missense probably damaging 1.00
R6363:Srgap2 UTSW 1 131298468 missense probably damaging 1.00
R6770:Srgap2 UTSW 1 131298510 missense probably benign 0.00
R6934:Srgap2 UTSW 1 131317231 missense possibly damaging 0.81
R7007:Srgap2 UTSW 1 131319537 missense probably benign 0.15
R7077:Srgap2 UTSW 1 131344449 missense
R7147:Srgap2 UTSW 1 131310594 missense
R7326:Srgap2 UTSW 1 131291613 nonsense probably null
R7467:Srgap2 UTSW 1 131292667 missense probably damaging 0.97
R7500:Srgap2 UTSW 1 131436831 missense probably damaging 1.00
R7579:Srgap2 UTSW 1 131292633 missense probably damaging 0.99
R7923:Srgap2 UTSW 1 131300413 missense possibly damaging 0.81
R7989:Srgap2 UTSW 1 131298432 missense
R8283:Srgap2 UTSW 1 131364033 missense probably damaging 0.99
R8708:Srgap2 UTSW 1 131345806 nonsense probably null
R8784:Srgap2 UTSW 1 131295474 missense unknown
X0022:Srgap2 UTSW 1 131411949 missense probably benign 0.01
Z1177:Srgap2 UTSW 1 131355510 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGTCAGGAGCTTAAACAGG -3'
(R):5'- AAGCTCAGGTACTAGAAGGGCC -3'

Sequencing Primer
(F):5'- CCAGGGCTTAACTCTGGC -3'
(R):5'- TCAGGTACTAGAAGGGCCTCCAG -3'
Posted On2018-04-27