Mutagenetix > Incidental Mutations

Incidental Mutation 'R6341:Ints7'

514364

Institutional Source

Beutler Lab

Gene Symbol

Ints7

Ensembl Gene

ENSMUSG00000037461

Gene Name

integrator complex subunit 7

Synonyms

5930412E23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R6341 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

191575636-191623688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 191613127 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 643 (T643K)

Ref Sequence

ENSEMBL: ENSMUSP00000036277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045450] [ENSMUST00000193569] [ENSMUST00000194785] [ENSMUST00000194877]

Predicted Effect

probably damaging
Transcript: ENSMUST00000045450
AA Change: T643K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000036277
Gene: ENSMUSG00000037461
AA Change: T643K

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	76	530	1e-10	SMART
low complexity region	937	960	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193569

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193961

Predicted Effect

probably benign
Transcript: ENSMUST00000194785

Predicted Effect

probably benign
Transcript: ENSMUST00000194877

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the integrator complex. The integrator complex associates with the C-terminal domain of RNA polymerase II and mediates 3'-end processing of the small nuclear RNAs U1 and U2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	T	C	16: 31,105,546	D658G	possibly damaging	Het
Amz2	A	G	11: 109,428,827	H13R	probably benign	Het
Ankrd27	G	T	7: 35,627,403		probably null	Het
Atp8a1	T	C	5: 67,682,927	T704A	possibly damaging	Het
Cabin1	A	T	10: 75,658,739	M1602K	probably damaging	Het
Ccdc74a	T	C	16: 17,648,114	S105P	probably damaging	Het
Cdh26	T	A	2: 178,471,573		probably null	Het
Cxcl10	T	C	5: 92,348,213	I22V	probably benign	Het
Cyp2c68	A	C	19: 39,712,489	V295G	possibly damaging	Het
Ddx10	A	T	9: 53,204,251	D594E	probably benign	Het
Ddx5	T	C	11: 106,785,542		probably null	Het
Ddx58	T	A	4: 40,222,199		probably null	Het
Duox1	T	C	2: 122,337,721	I1109T	probably damaging	Het
Dusp15	T	C	2: 152,946,284		probably null	Het
Ecel1	A	G	1: 87,150,471		probably null	Het
Efcab6	T	G	15: 83,935,938	Q714P	possibly damaging	Het
Erc1	A	G	6: 119,777,998	L464P	possibly damaging	Het
Fam129c	C	T	8: 71,600,077	P65L	probably damaging	Het
Fam234a	T	A	17: 26,213,693	H494L	probably damaging	Het
Gfpt1	T	C	6: 87,088,145	V694A	probably damaging	Het
Gli2	T	C	1: 118,836,224	D1399G	probably damaging	Het
Gm10110	T	C	14: 89,896,708		noncoding transcript	Het
Hdac3	A	G	18: 37,944,164	L219P	probably damaging	Het
Hlcs	A	G	16: 94,231,163	F52S	probably damaging	Het
Ireb2	A	G	9: 54,908,780	I878M	probably damaging	Het
Itga3	A	T	11: 95,055,851		probably null	Het
Lrfn5	T	A	12: 61,843,582	Y552*	probably null	Het
Mafb	T	C	2: 160,366,451	T76A	probably damaging	Het
Man2b1	A	T	8: 85,095,399	S748C	probably damaging	Het
Mmp15	G	T	8: 95,365,463		probably null	Het
Mmp17	A	T	5: 129,601,955	R335W	probably damaging	Het
Muc5ac	A	T	7: 141,801,492	D1005V	probably damaging	Het
Myh3	T	C	11: 67,082,996	F165S	probably benign	Het
Nacc1	T	C	8: 84,674,791	D419G	probably benign	Het
Neb	G	A	2: 52,209,474	S4545L	probably damaging	Het
Npas2	T	C	1: 39,300,687	I106T	probably damaging	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr1448	T	C	19: 12,919,479	T277A	probably benign	Het
Pde4dip	T	A	3: 97,694,911	Q2283L	probably benign	Het
Phax	C	T	18: 56,573,101	T21M	possibly damaging	Het
Pitpnm1	A	T	19: 4,102,829	K79*	probably null	Het
Pkd1	T	A	17: 24,580,227	F2807I	probably damaging	Het
Plekha4	C	T	7: 45,541,148	R427C	probably damaging	Het
Ptprj	A	T	2: 90,458,349	F757L	probably benign	Het
Rad1	A	G	15: 10,492,821	D208G	probably damaging	Het
Rangrf	T	A	11: 68,972,712	N156I	probably benign	Het
Rasl11b	T	C	5: 74,198,376	S181P	probably damaging	Het
Rlf	G	A	4: 121,149,360	Q808*	probably null	Het
Rogdi	G	T	16: 5,013,377		probably null	Het
Sec24a	A	T	11: 51,717,776	V573D	probably damaging	Het
Sorbs2	A	G	8: 45,770,578	T200A	probably damaging	Het
Srgap2	C	T	1: 131,291,629	R259H	probably benign	Het
Ssc5d	T	A	7: 4,936,665	V700E	probably benign	Het
Stt3a	A	T	9: 36,751,296	H222Q	probably damaging	Het
Tcaf3	A	T	6: 42,597,259	D6E	possibly damaging	Het
Tdrd12	C	T	7: 35,490,048	R421H	probably damaging	Het
Top3b	T	C	16: 16,879,071	M62T	probably damaging	Het
Trhr	T	G	15: 44,229,298	Y310*	probably null	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp34	A	G	11: 23,381,353	T1085A	probably damaging	Het
Vmn1r179	T	A	7: 23,929,066	H227Q	possibly damaging	Het
Vmn1r31	A	T	6: 58,472,010	M290K	probably benign	Het
Wdr75	T	C	1: 45,802,131		probably null	Het
Wnk1	A	T	6: 119,948,585	V1306D	probably damaging	Het
Xkr4	T	C	1: 3,670,778	T191A	probably benign	Het
Zc3h15	A	G	2: 83,661,223	E265G	probably benign	Het
Zcchc9	A	G	13: 91,800,697	F41S	possibly damaging	Het
Zfp251	T	C	15: 76,854,137	H247R	probably damaging	Het
Zfp433	A	G	10: 81,720,123	E152G	probably damaging	Het
Zfp770	A	T	2: 114,196,759	S276R	probably benign	Het

Other mutations in Ints7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ints7	APN	1	191596164	splice site	probably null
IGL01285:Ints7	APN	1	191615778	missense	probably benign	0.00
IGL01289:Ints7	APN	1	191615778	missense	probably benign	0.00
IGL01572:Ints7	APN	1	191615793	missense	possibly damaging	0.71
IGL01665:Ints7	APN	1	191613219	splice site	probably benign
IGL02059:Ints7	APN	1	191615760	missense	probably benign	0.23
IGL02684:Ints7	APN	1	191613637	critical splice acceptor site	probably null
IGL02686:Ints7	APN	1	191586592	missense	probably damaging	1.00
IGL02812:Ints7	APN	1	191619741	missense	probably damaging	1.00
IGL03119:Ints7	APN	1	191610365	missense	probably damaging	1.00
IGL03162:Ints7	APN	1	191621412	utr 3 prime	probably benign
PIT4810001:Ints7	UTSW	1	191596236	missense	probably damaging	0.99
R0294:Ints7	UTSW	1	191611891	missense	possibly damaging	0.91
R0479:Ints7	UTSW	1	191614554	splice site	probably null
R0698:Ints7	UTSW	1	191594464	missense	probably damaging	0.97
R1420:Ints7	UTSW	1	191613057	missense	possibly damaging	0.73
R1680:Ints7	UTSW	1	191621162	splice site	probably null
R1781:Ints7	UTSW	1	191596284	missense	possibly damaging	0.95
R2141:Ints7	UTSW	1	191604860	missense	possibly damaging	0.73
R2291:Ints7	UTSW	1	191606203	splice site	probably null
R4718:Ints7	UTSW	1	191583277	missense	possibly damaging	0.60
R4741:Ints7	UTSW	1	191619635	missense	probably benign	0.29
R4797:Ints7	UTSW	1	191596933	missense	probably damaging	1.00
R4812:Ints7	UTSW	1	191594430	missense	possibly damaging	0.73
R4826:Ints7	UTSW	1	191611906	missense	probably damaging	0.97
R4870:Ints7	UTSW	1	191596331	missense	probably damaging	0.97
R5169:Ints7	UTSW	1	191613090	missense	probably benign	0.00
R5281:Ints7	UTSW	1	191615771	missense	possibly damaging	0.90
R5694:Ints7	UTSW	1	191586618	missense	probably damaging	1.00
R5752:Ints7	UTSW	1	191575893	missense	probably benign	0.00
R6048:Ints7	UTSW	1	191621412	utr 3 prime	probably benign
R6419:Ints7	UTSW	1	191602302	missense	possibly damaging	0.69
R7037:Ints7	UTSW	1	191619605	missense	probably benign	0.16
R7163:Ints7	UTSW	1	191617837	missense	possibly damaging	0.67
R7603:Ints7	UTSW	1	191596224	missense	probably damaging	1.00
R7801:Ints7	UTSW	1	191615747	missense	possibly damaging	0.84
R7899:Ints7	UTSW	1	191621315	missense	probably damaging	1.00
R8034:Ints7	UTSW	1	191613068	frame shift	probably null
R8034:Ints7	UTSW	1	191613071	frame shift	probably null
R8231:Ints7	UTSW	1	191596353	nonsense	probably null
R8251:Ints7	UTSW	1	191621433	missense	unknown
R8520:Ints7	UTSW	1	191582491	missense	probably damaging	1.00
Z1177:Ints7	UTSW	1	191610458	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ATGTGCGTTCCATCCTAGTGC -3'
(R):5'- ATCCGGCCAAACATTGAGAG -3'

Sequencing Primer
(F):5'- AGTGCACTTCCTCCCTGAG -3'
(R):5'- TGAGAGTGAGTACTTGACACATACC -3'

Posted On

2018-04-27