Mutagenetix > Incidental Mutation

Incidental Mutation 'R6341:Ptprj'

514367

Institutional Source

Beutler Lab

Gene Symbol

Ptprj

Ensembl Gene

ENSMUSG00000025314

Gene Name

protein tyrosine phosphatase, receptor type, J

Synonyms

CD148, Byp, Scc1, Scc-1, DEP-1, RPTPJ

MMRRC Submission

044495-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.167) question?

Stock #

R6341 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90429754-90580647 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90458349 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 757 (F757L)

Ref Sequence

ENSEMBL: ENSMUSP00000129592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111493] [ENSMUST00000111495] [ENSMUST00000168621]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000111493
AA Change: F571L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107119
Gene: ENSMUSG00000025314
AA Change: F571L

Domain	Start	End	E-Value	Type
low complexity region	34	46	N/A	INTRINSIC
FN3	47	182	3.76e-6	SMART
FN3	194	271	4.56e-5	SMART
FN3	282	357	5.32e-6	SMART
FN3	368	446	2.19e-7	SMART
FN3	455	531	5e-2	SMART
FN3	546	628	2.77e1	SMART
low complexity region	637	650	N/A	INTRINSIC
Blast:PTPc	714	797	8e-26	BLAST
PTPc	867	1127	3.37e-133	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111495
AA Change: F664L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107121
Gene: ENSMUSG00000025314
AA Change: F664L

Domain	Start	End	E-Value	Type
low complexity region	14	25	N/A	INTRINSIC
FN3	59	131	2.85e-6	SMART
FN3	140	275	3.76e-6	SMART
FN3	287	364	4.56e-5	SMART
FN3	375	450	5.32e-6	SMART
FN3	461	539	2.19e-7	SMART
FN3	548	624	5e-2	SMART
FN3	639	721	2.77e1	SMART
low complexity region	730	743	N/A	INTRINSIC
Blast:PTPc	807	890	1e-25	BLAST
PTPc	960	1220	3.37e-133	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168621
AA Change: F757L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129592
Gene: ENSMUSG00000025314
AA Change: F757L

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
low complexity region	26	94	N/A	INTRINSIC
low complexity region	133	140	N/A	INTRINSIC
FN3	152	224	2.85e-6	SMART
FN3	233	368	3.76e-6	SMART
FN3	380	457	4.56e-5	SMART
FN3	468	543	5.32e-6	SMART
FN3	554	632	2.19e-7	SMART
FN3	641	717	5e-2	SMART
FN3	732	814	2.77e1	SMART
low complexity region	823	836	N/A	INTRINSIC
Blast:PTPc	900	983	1e-25	BLAST
PTPc	1053	1313	3.37e-133	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. This protein is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die in utero displaying severe growth retardation and cardiovascular defects. Homozygotes for a second null allele are viable, fertile and healthy with no spontaneous tumor formation. Homozygotes for a third null allele show sterility and a block B cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	T	C	16: 31,105,546	D658G	possibly damaging	Het
Amz2	A	G	11: 109,428,827	H13R	probably benign	Het
Ankrd27	G	T	7: 35,627,403		probably null	Het
Atp8a1	T	C	5: 67,682,927	T704A	possibly damaging	Het
Cabin1	A	T	10: 75,658,739	M1602K	probably damaging	Het
Ccdc74a	T	C	16: 17,648,114	S105P	probably damaging	Het
Cdh26	T	A	2: 178,471,573		probably null	Het
Cxcl10	T	C	5: 92,348,213	I22V	probably benign	Het
Cyp2c68	A	C	19: 39,712,489	V295G	possibly damaging	Het
Ddx10	A	T	9: 53,204,251	D594E	probably benign	Het
Ddx5	T	C	11: 106,785,542		probably null	Het
Ddx58	T	A	4: 40,222,199		probably null	Het
Duox1	T	C	2: 122,337,721	I1109T	probably damaging	Het
Dusp15	T	C	2: 152,946,284		probably null	Het
Ecel1	A	G	1: 87,150,471		probably null	Het
Efcab6	T	G	15: 83,935,938	Q714P	possibly damaging	Het
Erc1	A	G	6: 119,777,998	L464P	possibly damaging	Het
Fam129c	C	T	8: 71,600,077	P65L	probably damaging	Het
Fam234a	T	A	17: 26,213,693	H494L	probably damaging	Het
Gfpt1	T	C	6: 87,088,145	V694A	probably damaging	Het
Gli2	T	C	1: 118,836,224	D1399G	probably damaging	Het
Gm10110	T	C	14: 89,896,708		noncoding transcript	Het
Hdac3	A	G	18: 37,944,164	L219P	probably damaging	Het
Hlcs	A	G	16: 94,231,163	F52S	probably damaging	Het
Ints7	C	A	1: 191,613,127	T643K	probably damaging	Het
Ireb2	A	G	9: 54,908,780	I878M	probably damaging	Het
Itga3	A	T	11: 95,055,851		probably null	Het
Lrfn5	T	A	12: 61,843,582	Y552*	probably null	Het
Mafb	T	C	2: 160,366,451	T76A	probably damaging	Het
Man2b1	A	T	8: 85,095,399	S748C	probably damaging	Het
Mmp15	G	T	8: 95,365,463		probably null	Het
Mmp17	A	T	5: 129,601,955	R335W	probably damaging	Het
Muc5ac	A	T	7: 141,801,492	D1005V	probably damaging	Het
Myh3	T	C	11: 67,082,996	F165S	probably benign	Het
Nacc1	T	C	8: 84,674,791	D419G	probably benign	Het
Neb	G	A	2: 52,209,474	S4545L	probably damaging	Het
Npas2	T	C	1: 39,300,687	I106T	probably damaging	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr1448	T	C	19: 12,919,479	T277A	probably benign	Het
Pde4dip	T	A	3: 97,694,911	Q2283L	probably benign	Het
Phax	C	T	18: 56,573,101	T21M	possibly damaging	Het
Pitpnm1	A	T	19: 4,102,829	K79*	probably null	Het
Pkd1	T	A	17: 24,580,227	F2807I	probably damaging	Het
Plekha4	C	T	7: 45,541,148	R427C	probably damaging	Het
Rad1	A	G	15: 10,492,821	D208G	probably damaging	Het
Rangrf	T	A	11: 68,972,712	N156I	probably benign	Het
Rasl11b	T	C	5: 74,198,376	S181P	probably damaging	Het
Rlf	G	A	4: 121,149,360	Q808*	probably null	Het
Rogdi	G	T	16: 5,013,377		probably null	Het
Sec24a	A	T	11: 51,717,776	V573D	probably damaging	Het
Sorbs2	A	G	8: 45,770,578	T200A	probably damaging	Het
Srgap2	C	T	1: 131,291,629	R259H	probably benign	Het
Ssc5d	T	A	7: 4,936,665	V700E	probably benign	Het
Stt3a	A	T	9: 36,751,296	H222Q	probably damaging	Het
Tcaf3	A	T	6: 42,597,259	D6E	possibly damaging	Het
Tdrd12	C	T	7: 35,490,048	R421H	probably damaging	Het
Top3b	T	C	16: 16,879,071	M62T	probably damaging	Het
Trhr	T	G	15: 44,229,298	Y310*	probably null	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp34	A	G	11: 23,381,353	T1085A	probably damaging	Het
Vmn1r179	T	A	7: 23,929,066	H227Q	possibly damaging	Het
Vmn1r31	A	T	6: 58,472,010	M290K	probably benign	Het
Wdr75	T	C	1: 45,802,131		probably null	Het
Wnk1	A	T	6: 119,948,585	V1306D	probably damaging	Het
Xkr4	T	C	1: 3,670,778	T191A	probably benign	Het
Zc3h15	A	G	2: 83,661,223	E265G	probably benign	Het
Zcchc9	A	G	13: 91,800,697	F41S	possibly damaging	Het
Zfp251	T	C	15: 76,854,137	H247R	probably damaging	Het
Zfp433	A	G	10: 81,720,123	E152G	probably damaging	Het
Zfp770	A	T	2: 114,196,759	S276R	probably benign	Het

Other mutations in Ptprj

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01528:Ptprj	APN	2	90452144	missense	probably damaging	1.00
IGL01594:Ptprj	APN	2	90440795	splice site	probably benign
IGL01767:Ptprj	APN	2	90469574	missense	probably benign	0.11
IGL01917:Ptprj	APN	2	90469749	missense	probably damaging	1.00
IGL01981:Ptprj	APN	2	90439912	missense	probably damaging	1.00
IGL02830:Ptprj	APN	2	90453144	missense	probably benign	0.22
IGL02955:Ptprj	APN	2	90468464	critical splice acceptor site	probably null
IGL03102:Ptprj	APN	2	90478968	missense	probably benign	0.02
IGL03150:Ptprj	APN	2	90460611	missense	probably damaging	0.98
IGL03210:Ptprj	APN	2	90469726	missense	probably benign	0.01
IGL02799:Ptprj	UTSW	2	90469598	missense	probably benign	0.00
R0083:Ptprj	UTSW	2	90469777	splice site	probably null
R0108:Ptprj	UTSW	2	90469777	splice site	probably null
R0579:Ptprj	UTSW	2	90436569	critical splice acceptor site	probably null
R1130:Ptprj	UTSW	2	90453421	missense	probably damaging	1.00
R1160:Ptprj	UTSW	2	90444524	missense	probably damaging	1.00
R1238:Ptprj	UTSW	2	90444414	splice site	probably null
R1507:Ptprj	UTSW	2	90471287	missense	possibly damaging	0.87
R1552:Ptprj	UTSW	2	90471153	missense	probably damaging	0.98
R1607:Ptprj	UTSW	2	90463320	missense	probably benign	0.14
R1693:Ptprj	UTSW	2	90449797	nonsense	probably null
R2016:Ptprj	UTSW	2	90464614	missense	probably damaging	1.00
R2017:Ptprj	UTSW	2	90464614	missense	probably damaging	1.00
R2044:Ptprj	UTSW	2	90463095	missense	probably damaging	0.96
R2322:Ptprj	UTSW	2	90471129	missense	probably benign	0.06
R2516:Ptprj	UTSW	2	90474996	splice site	probably benign
R3106:Ptprj	UTSW	2	90440631	missense	probably damaging	1.00
R3964:Ptprj	UTSW	2	90468441	missense	probably benign	0.00
R4201:Ptprj	UTSW	2	90463095	missense	probably damaging	0.99
R4533:Ptprj	UTSW	2	90439955	missense	probably damaging	1.00
R4680:Ptprj	UTSW	2	90460496	missense	probably benign	0.00
R4738:Ptprj	UTSW	2	90440643	missense	probably damaging	1.00
R4983:Ptprj	UTSW	2	90460532	missense	probably damaging	0.98
R5137:Ptprj	UTSW	2	90469648	missense	possibly damaging	0.70
R5349:Ptprj	UTSW	2	90471261	missense	probably benign	0.00
R5369:Ptprj	UTSW	2	90469641	missense	probably benign	0.09
R5718:Ptprj	UTSW	2	90458269	missense	probably benign	0.00
R5914:Ptprj	UTSW	2	90453340	missense	possibly damaging	0.81
R6022:Ptprj	UTSW	2	90471323	missense	probably benign	0.14
R6421:Ptprj	UTSW	2	90471140	missense	possibly damaging	0.62
R6724:Ptprj	UTSW	2	90450851	missense	probably benign	0.04
R6831:Ptprj	UTSW	2	90460647	missense	probably damaging	1.00
R6939:Ptprj	UTSW	2	90459514	missense	possibly damaging	0.68
R6972:Ptprj	UTSW	2	90580403	missense	possibly damaging	0.91
R7134:Ptprj	UTSW	2	90464478	missense	probably benign	0.16
R7149:Ptprj	UTSW	2	90444446	missense	possibly damaging	0.95
R7243:Ptprj	UTSW	2	90446421	missense	probably damaging	0.96
R7335:Ptprj	UTSW	2	90440782	missense	probably benign	0.01
R7439:Ptprj	UTSW	2	90449819	missense	possibly damaging	0.82
R7441:Ptprj	UTSW	2	90449819	missense	possibly damaging	0.82
R7498:Ptprj	UTSW	2	90436565	nonsense	probably null
R7571:Ptprj	UTSW	2	90455186	missense	probably benign	0.24
R7657:Ptprj	UTSW	2	90452157	splice site	probably null
R7672:Ptprj	UTSW	2	90460596	missense	possibly damaging	0.49
R7849:Ptprj	UTSW	2	90444460	missense	probably damaging	0.98
R7939:Ptprj	UTSW	2	90464665	missense	probably damaging	1.00
R7958:Ptprj	UTSW	2	90469627	missense	possibly damaging	0.71
R8338:Ptprj	UTSW	2	90471137	missense	possibly damaging	0.48
R8354:Ptprj	UTSW	2	90469717	missense	probably benign	0.43
R8556:Ptprj	UTSW	2	90440700	missense	probably damaging	1.00
R8695:Ptprj	UTSW	2	90471137	missense	possibly damaging	0.48
R8784:Ptprj	UTSW	2	90460512	missense	possibly damaging	0.49
R8984:Ptprj	UTSW	2	90440643	missense	probably damaging	1.00
R9054:Ptprj	UTSW	2	90460640	missense	probably damaging	1.00
R9056:Ptprj	UTSW	2	90458269	missense	probably benign	0.00
R9147:Ptprj	UTSW	2	90458218	missense	probably benign	0.02
R9148:Ptprj	UTSW	2	90458218	missense	probably benign	0.02
R9168:Ptprj	UTSW	2	90464572	missense	possibly damaging	0.62
R9314:Ptprj	UTSW	2	90471287	missense	possibly damaging	0.87
R9337:Ptprj	UTSW	2	90439894	missense	probably damaging	1.00
R9546:Ptprj	UTSW	2	90444461	missense	probably benign	0.08
RF013:Ptprj	UTSW	2	90471170	nonsense	probably null
Z1177:Ptprj	UTSW	2	90460569	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTTCCCACATGACAAGGTG -3'
(R):5'- TAAGGTGACTGATGCAAGGTC -3'

Sequencing Primer
(F):5'- CATGACAAGGTGGCGATGCTG -3'
(R):5'- TAGTGAAGCCGAGCATCTTC -3'

Posted On

2018-04-27