Incidental Mutation 'R6341:Mafb'
ID514371
Institutional Source Beutler Lab
Gene Symbol Mafb
Ensembl Gene ENSMUSG00000074622
Gene Namev-maf musculoaponeurotic fibrosarcoma oncogene family, protein B (avian)
SynonymsKrml1, Krml, Kreisler
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock #R6341 (G1)
Quality Score144.008
Status Not validated
Chromosome2
Chromosomal Location160363703-160367065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160366451 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 76 (T76A)
Ref Sequence ENSEMBL: ENSMUSP00000096728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099126]
PDB Structure Crystal structure of the bZIP heterodimeric complex MafB:cFos bound to DNA [X-RAY DIFFRACTION]
Crystal structure of the homodimeric MafB in complex with the T-MARE binding site [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE BZIP HOMODIMERIC MAFB IN COMPLEX WITH THE C- MARE BINDING SITE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000099126
AA Change: T76A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096728
Gene: ENSMUSG00000074622
AA Change: T76A

DomainStartEndE-ValueType
low complexity region 54 78 N/A INTRINSIC
Pfam:Maf_N 80 113 2.1e-24 PFAM
low complexity region 131 143 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
BRLZ 234 300 2.73e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a basic leucine zipper (bZIP) transcription factor that plays an important role in the regulation of lineage-specific hematopoiesis. The encoded nuclear protein represses ETS1-mediated transcription of erythroid-specific genes in myeloid cells. This gene contains no introns. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant homozygotes exhibit segmentation defects in the caudal hindbrain, loss of facial motor neurons, impaired inner ear development, arrested maturation of kidney podocytes, reduced fertility, and, in some cases, lethality at birth from apnea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Mafb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01827:Mafb APN 2 160366478 missense probably damaging 1.00
IGL02077:Mafb APN 2 160365767 missense probably benign 0.32
R2240:Mafb UTSW 2 160366027 missense probably damaging 1.00
R2510:Mafb UTSW 2 160366576 missense probably damaging 1.00
R5784:Mafb UTSW 2 160366541 missense probably damaging 0.99
R6885:Mafb UTSW 2 160366019 missense possibly damaging 0.81
R7555:Mafb UTSW 2 160365829 missense probably damaging 1.00
R7658:Mafb UTSW 2 160366435 missense possibly damaging 0.68
R8146:Mafb UTSW 2 160366378 missense probably damaging 1.00
R8356:Mafb UTSW 2 160366205 missense probably benign 0.33
Z1177:Mafb UTSW 2 160366505 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ATCGTGAGTCACACCTGCTC -3'
(R):5'- ACGTCAACGACTTCGACCTTC -3'

Sequencing Primer
(F):5'- ACACCTGCTCCTGGGTAC -3'
(R):5'- GACCTTCTCAAGTTCGACGTGAAG -3'
Posted On2018-04-27