Mutagenetix > Incidental Mutation

Incidental Mutation 'R6341:Pde4dip'

514373

Institutional Source

Beutler Lab

Gene Symbol

Pde4dip

Ensembl Gene

ENSMUSG00000038170

Gene Name

phosphodiesterase 4D interacting protein (myomegalin)

Synonyms

D130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik

MMRRC Submission

Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6341 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

97689824-97888707 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 97694911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 2283 (Q2283L)

Ref Sequence

ENSEMBL: ENSMUSP00000131170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000090750
AA Change: Q2334L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: Q2334L

Domain	Start	End	E-Value	Type
low complexity region	10	40	N/A	INTRINSIC
low complexity region	45	57	N/A	INTRINSIC
Pfam:Cnn_1N	124	196	3.2e-26	PFAM
low complexity region	204	219	N/A	INTRINSIC
coiled coil region	282	325	N/A	INTRINSIC
internal_repeat_1	397	438	4.03e-5	PROSPERO
low complexity region	567	578	N/A	INTRINSIC
internal_repeat_2	617	667	6.59e-5	PROSPERO
internal_repeat_1	620	661	4.03e-5	PROSPERO
coiled coil region	866	942	N/A	INTRINSIC
low complexity region	1038	1056	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
coiled coil region	1118	1163	N/A	INTRINSIC
coiled coil region	1336	1363	N/A	INTRINSIC
low complexity region	1403	1420	N/A	INTRINSIC
coiled coil region	1470	1508	N/A	INTRINSIC
internal_repeat_2	1597	1644	6.59e-5	PROSPERO
DUF1220	1680	1747	1.17e-17	SMART
low complexity region	1758	1780	N/A	INTRINSIC
low complexity region	1836	1851	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
low complexity region	1940	1951	N/A	INTRINSIC
coiled coil region	1962	2138	N/A	INTRINSIC
coiled coil region	2162	2197	N/A	INTRINSIC
coiled coil region	2387	2431	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168438
AA Change: Q2283L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: Q2283L

Domain	Start	End	E-Value	Type
low complexity region	10	40	N/A	INTRINSIC
low complexity region	45	57	N/A	INTRINSIC
Pfam:Microtub_assoc	124	198	1.4e-31	PFAM
low complexity region	204	219	N/A	INTRINSIC
coiled coil region	282	325	N/A	INTRINSIC
internal_repeat_1	397	438	3.56e-5	PROSPERO
low complexity region	567	578	N/A	INTRINSIC
internal_repeat_2	617	667	5.83e-5	PROSPERO
internal_repeat_1	620	661	3.56e-5	PROSPERO
coiled coil region	866	942	N/A	INTRINSIC
low complexity region	1038	1056	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
coiled coil region	1118	1163	N/A	INTRINSIC
coiled coil region	1336	1363	N/A	INTRINSIC
low complexity region	1403	1420	N/A	INTRINSIC
coiled coil region	1470	1508	N/A	INTRINSIC
internal_repeat_2	1597	1644	5.83e-5	PROSPERO
DUF1220	1680	1747	1.17e-17	SMART
low complexity region	1758	1769	N/A	INTRINSIC
low complexity region	1785	1800	N/A	INTRINSIC
low complexity region	1809	1823	N/A	INTRINSIC
low complexity region	1889	1900	N/A	INTRINSIC
coiled coil region	1911	2087	N/A	INTRINSIC
coiled coil region	2111	2146	N/A	INTRINSIC
coiled coil region	2336	2380	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184178

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197791

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200063

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	T	C	16: 31,105,546	D658G	possibly damaging	Het
Amz2	A	G	11: 109,428,827	H13R	probably benign	Het
Ankrd27	G	T	7: 35,627,403		probably null	Het
Atp8a1	T	C	5: 67,682,927	T704A	possibly damaging	Het
Cabin1	A	T	10: 75,658,739	M1602K	probably damaging	Het
Ccdc74a	T	C	16: 17,648,114	S105P	probably damaging	Het
Cdh26	T	A	2: 178,471,573		probably null	Het
Cxcl10	T	C	5: 92,348,213	I22V	probably benign	Het
Cyp2c68	A	C	19: 39,712,489	V295G	possibly damaging	Het
Ddx10	A	T	9: 53,204,251	D594E	probably benign	Het
Ddx5	T	C	11: 106,785,542		probably null	Het
Ddx58	T	A	4: 40,222,199		probably null	Het
Duox1	T	C	2: 122,337,721	I1109T	probably damaging	Het
Dusp15	T	C	2: 152,946,284		probably null	Het
Ecel1	A	G	1: 87,150,471		probably null	Het
Efcab6	T	G	15: 83,935,938	Q714P	possibly damaging	Het
Erc1	A	G	6: 119,777,998	L464P	possibly damaging	Het
Fam129c	C	T	8: 71,600,077	P65L	probably damaging	Het
Fam234a	T	A	17: 26,213,693	H494L	probably damaging	Het
Gfpt1	T	C	6: 87,088,145	V694A	probably damaging	Het
Gli2	T	C	1: 118,836,224	D1399G	probably damaging	Het
Gm10110	T	C	14: 89,896,708		noncoding transcript	Het
Hdac3	A	G	18: 37,944,164	L219P	probably damaging	Het
Hlcs	A	G	16: 94,231,163	F52S	probably damaging	Het
Ints7	C	A	1: 191,613,127	T643K	probably damaging	Het
Ireb2	A	G	9: 54,908,780	I878M	probably damaging	Het
Itga3	A	T	11: 95,055,851		probably null	Het
Lrfn5	T	A	12: 61,843,582	Y552*	probably null	Het
Mafb	T	C	2: 160,366,451	T76A	probably damaging	Het
Man2b1	A	T	8: 85,095,399	S748C	probably damaging	Het
Mmp15	G	T	8: 95,365,463		probably null	Het
Mmp17	A	T	5: 129,601,955	R335W	probably damaging	Het
Muc5ac	A	T	7: 141,801,492	D1005V	probably damaging	Het
Myh3	T	C	11: 67,082,996	F165S	probably benign	Het
Nacc1	T	C	8: 84,674,791	D419G	probably benign	Het
Neb	G	A	2: 52,209,474	S4545L	probably damaging	Het
Npas2	T	C	1: 39,300,687	I106T	probably damaging	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr1448	T	C	19: 12,919,479	T277A	probably benign	Het
Phax	C	T	18: 56,573,101	T21M	possibly damaging	Het
Pitpnm1	A	T	19: 4,102,829	K79*	probably null	Het
Pkd1	T	A	17: 24,580,227	F2807I	probably damaging	Het
Plekha4	C	T	7: 45,541,148	R427C	probably damaging	Het
Ptprj	A	T	2: 90,458,349	F757L	probably benign	Het
Rad1	A	G	15: 10,492,821	D208G	probably damaging	Het
Rangrf	T	A	11: 68,972,712	N156I	probably benign	Het
Rasl11b	T	C	5: 74,198,376	S181P	probably damaging	Het
Rlf	G	A	4: 121,149,360	Q808*	probably null	Het
Rogdi	G	T	16: 5,013,377		probably null	Het
Sec24a	A	T	11: 51,717,776	V573D	probably damaging	Het
Sorbs2	A	G	8: 45,770,578	T200A	probably damaging	Het
Srgap2	C	T	1: 131,291,629	R259H	probably benign	Het
Ssc5d	T	A	7: 4,936,665	V700E	probably benign	Het
Stt3a	A	T	9: 36,751,296	H222Q	probably damaging	Het
Tcaf3	A	T	6: 42,597,259	D6E	possibly damaging	Het
Tdrd12	C	T	7: 35,490,048	R421H	probably damaging	Het
Top3b	T	C	16: 16,879,071	M62T	probably damaging	Het
Trhr	T	G	15: 44,229,298	Y310*	probably null	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp34	A	G	11: 23,381,353	T1085A	probably damaging	Het
Vmn1r179	T	A	7: 23,929,066	H227Q	possibly damaging	Het
Vmn1r31	A	T	6: 58,472,010	M290K	probably benign	Het
Wdr75	T	C	1: 45,802,131		probably null	Het
Wnk1	A	T	6: 119,948,585	V1306D	probably damaging	Het
Xkr4	T	C	1: 3,670,778	T191A	probably benign	Het
Zc3h15	A	G	2: 83,661,223	E265G	probably benign	Het
Zcchc9	A	G	13: 91,800,697	F41S	possibly damaging	Het
Zfp251	T	C	15: 76,854,137	H247R	probably damaging	Het
Zfp433	A	G	10: 81,720,123	E152G	probably damaging	Het
Zfp770	A	T	2: 114,196,759	S276R	probably benign	Het

Other mutations in Pde4dip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Pde4dip	APN	3	97767277	missense	probably benign	0.00
IGL00543:Pde4dip	APN	3	97757624	missense	possibly damaging	0.91
IGL00979:Pde4dip	APN	3	97747758	splice site	probably benign
IGL01483:Pde4dip	APN	3	97754149	missense	probably damaging	1.00
IGL02122:Pde4dip	APN	3	97767421	missense	probably damaging	1.00
IGL02398:Pde4dip	APN	3	97766781	missense	probably benign
IGL02814:Pde4dip	APN	3	97767100	missense	probably damaging	1.00
IGL02826:Pde4dip	APN	3	97767087	missense	probably damaging	1.00
D3080:Pde4dip	UTSW	3	97766830	missense	probably damaging	1.00
R0077:Pde4dip	UTSW	3	97753126	nonsense	probably null
R0096:Pde4dip	UTSW	3	97767467	missense	probably damaging	0.99
R0277:Pde4dip	UTSW	3	97843712	missense	probably benign	0.01
R0304:Pde4dip	UTSW	3	97843712	missense	probably benign	0.01
R0616:Pde4dip	UTSW	3	97747533	missense	probably benign	0.09
R0676:Pde4dip	UTSW	3	97717097	splice site	probably benign
R1166:Pde4dip	UTSW	3	97713196	missense	possibly damaging	0.94
R1376:Pde4dip	UTSW	3	97743217	missense	probably damaging	0.99
R1376:Pde4dip	UTSW	3	97743217	missense	probably damaging	0.99
R1452:Pde4dip	UTSW	3	97724102	missense	probably damaging	1.00
R1550:Pde4dip	UTSW	3	97719704	missense	probably damaging	1.00
R1700:Pde4dip	UTSW	3	97703323	missense	probably benign	0.00
R1704:Pde4dip	UTSW	3	97754260	missense	probably benign	0.28
R1769:Pde4dip	UTSW	3	97695930	missense	probably benign	0.00
R1934:Pde4dip	UTSW	3	97692691	missense	possibly damaging	0.74
R1980:Pde4dip	UTSW	3	97756996	missense	possibly damaging	0.93
R2088:Pde4dip	UTSW	3	97754433	missense	probably null	1.00
R2143:Pde4dip	UTSW	3	97888519	missense	possibly damaging	0.86
R2149:Pde4dip	UTSW	3	97792836	missense	possibly damaging	0.64
R2156:Pde4dip	UTSW	3	97724218	missense	probably damaging	0.98
R2158:Pde4dip	UTSW	3	97757621	missense	probably benign	0.15
R2240:Pde4dip	UTSW	3	97724164	missense	probably benign	0.00
R2249:Pde4dip	UTSW	3	97793525	missense	probably damaging	1.00
R2256:Pde4dip	UTSW	3	97718184	missense	probably damaging	1.00
R2680:Pde4dip	UTSW	3	97701617	missense	possibly damaging	0.92
R2921:Pde4dip	UTSW	3	97719569	missense	probably benign
R3407:Pde4dip	UTSW	3	97754468	missense	probably damaging	1.00
R3736:Pde4dip	UTSW	3	97724111	missense	probably damaging	1.00
R3787:Pde4dip	UTSW	3	97715552	missense	possibly damaging	0.80
R3883:Pde4dip	UTSW	3	97713188	missense	probably damaging	1.00
R4437:Pde4dip	UTSW	3	97766569	missense	possibly damaging	0.52
R4528:Pde4dip	UTSW	3	97717022	missense	probably damaging	1.00
R4576:Pde4dip	UTSW	3	97754249	missense	probably damaging	1.00
R4600:Pde4dip	UTSW	3	97695944	missense	probably damaging	0.98
R4653:Pde4dip	UTSW	3	97767338	missense	probably damaging	0.99
R4678:Pde4dip	UTSW	3	97695005	missense	probably damaging	1.00
R4679:Pde4dip	UTSW	3	97695005	missense	probably damaging	1.00
R4688:Pde4dip	UTSW	3	97843677	nonsense	probably null
R4770:Pde4dip	UTSW	3	97767084	missense	probably damaging	1.00
R4841:Pde4dip	UTSW	3	97793528	missense	probably damaging	1.00
R4842:Pde4dip	UTSW	3	97793528	missense	probably damaging	1.00
R4899:Pde4dip	UTSW	3	97709558	missense	probably damaging	1.00
R4914:Pde4dip	UTSW	3	97715328	missense	probably benign	0.10
R4943:Pde4dip	UTSW	3	97755511	missense	probably damaging	0.99
R5131:Pde4dip	UTSW	3	97709514	missense	probably damaging	0.98
R5408:Pde4dip	UTSW	3	97796736	missense	probably benign	0.35
R5583:Pde4dip	UTSW	3	97747576	missense	possibly damaging	0.67
R5677:Pde4dip	UTSW	3	97841648	nonsense	probably null
R5689:Pde4dip	UTSW	3	97692367	nonsense	probably null
R5696:Pde4dip	UTSW	3	97709490	missense	probably damaging	1.00
R5860:Pde4dip	UTSW	3	97724188	missense	possibly damaging	0.68
R6279:Pde4dip	UTSW	3	97699180	missense	probably damaging	1.00
R6440:Pde4dip	UTSW	3	97767586	missense	probably damaging	1.00
R6464:Pde4dip	UTSW	3	97710344	missense	probably damaging	1.00
R6489:Pde4dip	UTSW	3	97755591	nonsense	probably null
R6706:Pde4dip	UTSW	3	97741393	missense	probably damaging	1.00
R6722:Pde4dip	UTSW	3	97718239	nonsense	probably null
R6798:Pde4dip	UTSW	3	97888534	missense	probably benign
R6804:Pde4dip	UTSW	3	97793248	nonsense	probably null
R6862:Pde4dip	UTSW	3	97767024	missense	possibly damaging	0.52
R6957:Pde4dip	UTSW	3	97824333	splice site	probably null
R6983:Pde4dip	UTSW	3	97718236	missense	probably damaging	1.00
R7014:Pde4dip	UTSW	3	97715422	missense	possibly damaging	0.54
R7025:Pde4dip	UTSW	3	97724183	nonsense	probably null
R7136:Pde4dip	UTSW	3	97694063	missense	probably benign	0.03
R7178:Pde4dip	UTSW	3	97715630	missense	probably benign	0.26
R7269:Pde4dip	UTSW	3	97766959	missense	probably damaging	1.00
R7283:Pde4dip	UTSW	3	97758882	missense	probably benign	0.03
R7354:Pde4dip	UTSW	3	97719330	missense	probably damaging	0.99
R7357:Pde4dip	UTSW	3	97715541	missense	probably benign	0.01
R7360:Pde4dip	UTSW	3	97718316	missense	probably benign	0.01
R7371:Pde4dip	UTSW	3	97757271	missense	probably benign	0.08
R7432:Pde4dip	UTSW	3	97695092	missense	probably benign
R7536:Pde4dip	UTSW	3	97757244	missense	probably damaging	1.00
R7542:Pde4dip	UTSW	3	97766655	missense	possibly damaging	0.59
R7609:Pde4dip	UTSW	3	97715565	missense	possibly damaging	0.85
R7650:Pde4dip	UTSW	3	97699107	critical splice donor site	probably null
R7800:Pde4dip	UTSW	3	97715283	missense	probably damaging	1.00
R7846:Pde4dip	UTSW	3	97715174	missense	probably damaging	1.00
R7918:Pde4dip	UTSW	3	97715223	nonsense	probably null
R8120:Pde4dip	UTSW	3	97706938	missense	probably null	0.94
R8139:Pde4dip	UTSW	3	97696993	missense	probably benign	0.02
R8144:Pde4dip	UTSW	3	97715426	missense	probably damaging	1.00
R8177:Pde4dip	UTSW	3	97767532	missense	probably damaging	0.98
R8294:Pde4dip	UTSW	3	97767378	missense	probably damaging	1.00
R8406:Pde4dip	UTSW	3	97699112	missense	probably benign	0.04
R8911:Pde4dip	UTSW	3	97743601	missense	probably benign	0.22
R8912:Pde4dip	UTSW	3	97710317	missense	probably damaging	1.00
R8960:Pde4dip	UTSW	3	97793148	missense	probably damaging	1.00
R8993:Pde4dip	UTSW	3	97766494	missense	probably damaging	1.00
R9031:Pde4dip	UTSW	3	97692359	missense	probably damaging	1.00
R9032:Pde4dip	UTSW	3	97694069	missense	probably benign	0.00
R9085:Pde4dip	UTSW	3	97694069	missense	probably benign	0.00
R9103:Pde4dip	UTSW	3	97841728	missense	probably damaging	1.00
R9163:Pde4dip	UTSW	3	97751807	critical splice donor site	probably null
R9182:Pde4dip	UTSW	3	97694998	missense	probably benign	0.13
R9185:Pde4dip	UTSW	3	97758816	missense	probably benign	0.01
R9286:Pde4dip	UTSW	3	97699867	missense	probably damaging	1.00
R9357:Pde4dip	UTSW	3	97718329	missense	probably benign	0.00
R9415:Pde4dip	UTSW	3	97753152	missense	possibly damaging	0.82
R9500:Pde4dip	UTSW	3	97888580	missense	unknown
R9595:Pde4dip	UTSW	3	97694891	critical splice donor site	probably null
R9689:Pde4dip	UTSW	3	97742525	missense	probably damaging	1.00
R9720:Pde4dip	UTSW	3	97695971	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTATCATGAAGTGCAGGGTTTTC -3'
(R):5'- AAGCTGGAGGTCGATGCTAC -3'

Sequencing Primer
(F):5'- ATCAAGTCAGCCTGTTCTGTAGCAG -3'
(R):5'- GATGCTACCGATGGCCCATTTG -3'

Posted On

2018-04-27