Incidental Mutation 'R6341:Mmp17'
ID514379
Institutional Source Beutler Lab
Gene Symbol Mmp17
Ensembl Gene ENSMUSG00000029436
Gene Namematrix metallopeptidase 17
Synonymsmembrane type-4 matrix metalloproteinase, MT4-MMP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6341 (G1)
Quality Score199.009
Status Not validated
Chromosome5
Chromosomal Location129584169-129611099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129601955 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 335 (R335W)
Ref Sequence ENSEMBL: ENSMUSP00000031390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031390]
Predicted Effect probably damaging
Transcript: ENSMUST00000031390
AA Change: R335W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031390
Gene: ENSMUSG00000029436
AA Change: R335W

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:PG_binding_1 44 104 5e-15 PFAM
ZnMc 128 295 8.26e-47 SMART
low complexity region 308 320 N/A INTRINSIC
HX 340 384 3.17e-8 SMART
HX 389 432 2.59e-13 SMART
HX 435 481 6.39e-13 SMART
HX 483 527 1.1e-7 SMART
low complexity region 563 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177802
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype Strain: 3604575; 3777020
FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit dysfunctional vascular smooth muscle cells and altered extracellular matrix in the vessel wall leading to an increased susceptibility to angiotensin-II-induced thoracic aortic aneurysm. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal morphology, clinical chemistry, hematology and behavior. Mice homozygous for a reporter/null allele exhibit normal growth, fertility, and lifespan but show subtle renal developmental defects, hypodipsia, and elevated urine osmolarity. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Mmp17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mmp17 APN 5 129606408 missense probably benign 0.00
IGL01602:Mmp17 APN 5 129601944 missense probably benign 0.00
IGL01605:Mmp17 APN 5 129601944 missense probably benign 0.00
IGL01782:Mmp17 APN 5 129602141 missense probably damaging 1.00
IGL01986:Mmp17 APN 5 129596628 missense probably damaging 1.00
IGL02096:Mmp17 APN 5 129598688 nonsense probably null
IGL02160:Mmp17 APN 5 129595569 missense possibly damaging 0.91
IGL03075:Mmp17 APN 5 129595074 missense probably damaging 1.00
P0005:Mmp17 UTSW 5 129596631 missense probably benign 0.00
R0125:Mmp17 UTSW 5 129594582 missense possibly damaging 0.88
R0553:Mmp17 UTSW 5 129598670 missense probably benign 0.30
R1521:Mmp17 UTSW 5 129595088 splice site probably null
R1938:Mmp17 UTSW 5 129602126 missense probably damaging 1.00
R2151:Mmp17 UTSW 5 129605661 missense probably benign 0.01
R4908:Mmp17 UTSW 5 129605666 nonsense probably null
R4970:Mmp17 UTSW 5 129602165 missense possibly damaging 0.51
R5096:Mmp17 UTSW 5 129605563 missense probably damaging 1.00
R5112:Mmp17 UTSW 5 129602165 missense possibly damaging 0.51
R5178:Mmp17 UTSW 5 129595058 missense probably damaging 1.00
R5304:Mmp17 UTSW 5 129594614 missense probably null 0.89
R5341:Mmp17 UTSW 5 129602129 missense possibly damaging 0.50
R6501:Mmp17 UTSW 5 129606405 missense probably benign 0.00
R7257:Mmp17 UTSW 5 129595633 missense probably benign 0.03
R7371:Mmp17 UTSW 5 129605772 missense probably null 0.98
R7546:Mmp17 UTSW 5 129596589 missense probably damaging 1.00
R8026:Mmp17 UTSW 5 129595084 critical splice donor site probably null
R8370:Mmp17 UTSW 5 129605578 missense probably damaging 1.00
R8525:Mmp17 UTSW 5 129602207 missense probably damaging 1.00
R8708:Mmp17 UTSW 5 129595422 missense possibly damaging 0.67
R8803:Mmp17 UTSW 5 129598709 nonsense probably null
W0251:Mmp17 UTSW 5 129595527 missense probably benign 0.09
Y5377:Mmp17 UTSW 5 129595530 missense probably damaging 1.00
Y5380:Mmp17 UTSW 5 129595530 missense probably damaging 1.00
Z1177:Mmp17 UTSW 5 129595661 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTGACCTTGTTTGCCTGG -3'
(R):5'- CAGAAGCGATGCATTTGAGCC -3'

Sequencing Primer
(F):5'- GTTCTGGCAGGAATAGCT -3'
(R):5'- ATGCATTTGAGCCGGCTGC -3'
Posted On2018-04-27