Mutagenetix > Incidental Mutation

Incidental Mutation 'R6341:Ssc5d'

514385

Institutional Source

Beutler Lab

Gene Symbol

Ssc5d

Ensembl Gene

ENSMUSG00000035279

Gene Name

scavenger receptor cysteine rich family, 5 domains

Synonyms

s5d-srcrb, A430110N23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6341 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4925785-4944826 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4936665 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 700 (V700E)

Ref Sequence

ENSEMBL: ENSMUSP00000052126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]

AlphaFold

Q8BV57

Predicted Effect

probably benign
Transcript: ENSMUST00000057612
AA Change: V700E

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: V700E

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SR	20	120	4.44e-49	SMART
low complexity region	141	155	N/A	INTRINSIC
low complexity region	167	182	N/A	INTRINSIC
SR	199	299	2.36e-53	SMART
SR	305	405	8.22e-53	SMART
low complexity region	437	462	N/A	INTRINSIC
SR	464	565	1.11e-49	SMART
low complexity region	741	755	N/A	INTRINSIC
SR	758	858	3.93e-50	SMART
low complexity region	936	957	N/A	INTRINSIC
low complexity region	981	1004	N/A	INTRINSIC
low complexity region	1018	1035	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1357	1364	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207310

Predicted Effect

probably benign
Transcript: ENSMUST00000208109

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	T	C	16: 31,105,546	D658G	possibly damaging	Het
Amz2	A	G	11: 109,428,827	H13R	probably benign	Het
Ankrd27	G	T	7: 35,627,403		probably null	Het
Atp8a1	T	C	5: 67,682,927	T704A	possibly damaging	Het
Cabin1	A	T	10: 75,658,739	M1602K	probably damaging	Het
Ccdc74a	T	C	16: 17,648,114	S105P	probably damaging	Het
Cdh26	T	A	2: 178,471,573		probably null	Het
Cxcl10	T	C	5: 92,348,213	I22V	probably benign	Het
Cyp2c68	A	C	19: 39,712,489	V295G	possibly damaging	Het
Ddx10	A	T	9: 53,204,251	D594E	probably benign	Het
Ddx5	T	C	11: 106,785,542		probably null	Het
Ddx58	T	A	4: 40,222,199		probably null	Het
Duox1	T	C	2: 122,337,721	I1109T	probably damaging	Het
Dusp15	T	C	2: 152,946,284		probably null	Het
Ecel1	A	G	1: 87,150,471		probably null	Het
Efcab6	T	G	15: 83,935,938	Q714P	possibly damaging	Het
Erc1	A	G	6: 119,777,998	L464P	possibly damaging	Het
Fam129c	C	T	8: 71,600,077	P65L	probably damaging	Het
Fam234a	T	A	17: 26,213,693	H494L	probably damaging	Het
Gfpt1	T	C	6: 87,088,145	V694A	probably damaging	Het
Gli2	T	C	1: 118,836,224	D1399G	probably damaging	Het
Gm10110	T	C	14: 89,896,708		noncoding transcript	Het
Hdac3	A	G	18: 37,944,164	L219P	probably damaging	Het
Hlcs	A	G	16: 94,231,163	F52S	probably damaging	Het
Ints7	C	A	1: 191,613,127	T643K	probably damaging	Het
Ireb2	A	G	9: 54,908,780	I878M	probably damaging	Het
Itga3	A	T	11: 95,055,851		probably null	Het
Lrfn5	T	A	12: 61,843,582	Y552*	probably null	Het
Mafb	T	C	2: 160,366,451	T76A	probably damaging	Het
Man2b1	A	T	8: 85,095,399	S748C	probably damaging	Het
Mmp15	G	T	8: 95,365,463		probably null	Het
Mmp17	A	T	5: 129,601,955	R335W	probably damaging	Het
Muc5ac	A	T	7: 141,801,492	D1005V	probably damaging	Het
Myh3	T	C	11: 67,082,996	F165S	probably benign	Het
Nacc1	T	C	8: 84,674,791	D419G	probably benign	Het
Neb	G	A	2: 52,209,474	S4545L	probably damaging	Het
Npas2	T	C	1: 39,300,687	I106T	probably damaging	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr1448	T	C	19: 12,919,479	T277A	probably benign	Het
Pde4dip	T	A	3: 97,694,911	Q2283L	probably benign	Het
Phax	C	T	18: 56,573,101	T21M	possibly damaging	Het
Pitpnm1	A	T	19: 4,102,829	K79*	probably null	Het
Pkd1	T	A	17: 24,580,227	F2807I	probably damaging	Het
Plekha4	C	T	7: 45,541,148	R427C	probably damaging	Het
Ptprj	A	T	2: 90,458,349	F757L	probably benign	Het
Rad1	A	G	15: 10,492,821	D208G	probably damaging	Het
Rangrf	T	A	11: 68,972,712	N156I	probably benign	Het
Rasl11b	T	C	5: 74,198,376	S181P	probably damaging	Het
Rlf	G	A	4: 121,149,360	Q808*	probably null	Het
Rogdi	G	T	16: 5,013,377		probably null	Het
Sec24a	A	T	11: 51,717,776	V573D	probably damaging	Het
Sorbs2	A	G	8: 45,770,578	T200A	probably damaging	Het
Srgap2	C	T	1: 131,291,629	R259H	probably benign	Het
Stt3a	A	T	9: 36,751,296	H222Q	probably damaging	Het
Tcaf3	A	T	6: 42,597,259	D6E	possibly damaging	Het
Tdrd12	C	T	7: 35,490,048	R421H	probably damaging	Het
Top3b	T	C	16: 16,879,071	M62T	probably damaging	Het
Trhr	T	G	15: 44,229,298	Y310*	probably null	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp34	A	G	11: 23,381,353	T1085A	probably damaging	Het
Vmn1r179	T	A	7: 23,929,066	H227Q	possibly damaging	Het
Vmn1r31	A	T	6: 58,472,010	M290K	probably benign	Het
Wdr75	T	C	1: 45,802,131		probably null	Het
Wnk1	A	T	6: 119,948,585	V1306D	probably damaging	Het
Xkr4	T	C	1: 3,670,778	T191A	probably benign	Het
Zc3h15	A	G	2: 83,661,223	E265G	probably benign	Het
Zcchc9	A	G	13: 91,800,697	F41S	possibly damaging	Het
Zfp251	T	C	15: 76,854,137	H247R	probably damaging	Het
Zfp433	A	G	10: 81,720,123	E152G	probably damaging	Het
Zfp770	A	T	2: 114,196,759	S276R	probably benign	Het

Other mutations in Ssc5d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Ssc5d	APN	7	4944481	missense	possibly damaging	0.63
IGL00939:Ssc5d	APN	7	4936281	missense	possibly damaging	0.89
IGL01109:Ssc5d	APN	7	4937112	nonsense	probably null
IGL01409:Ssc5d	APN	7	4942809	missense	probably benign	0.16
IGL01880:Ssc5d	APN	7	4933219	missense	probably damaging	1.00
IGL02013:Ssc5d	APN	7	4943836	missense	probably benign	0.00
IGL02227:Ssc5d	APN	7	4933454	critical splice donor site	probably null
IGL02963:Ssc5d	APN	7	4944327	missense	probably benign	0.02
D4043:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
D4216:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
R0104:Ssc5d	UTSW	7	4936286	missense	probably benign	0.41
R0115:Ssc5d	UTSW	7	4927881	unclassified	probably benign
R0201:Ssc5d	UTSW	7	4944663	missense	probably benign
R0365:Ssc5d	UTSW	7	4928467	nonsense	probably null
R0485:Ssc5d	UTSW	7	4937471	missense	probably damaging	0.99
R0967:Ssc5d	UTSW	7	4944343	nonsense	probably null
R1607:Ssc5d	UTSW	7	4944043	missense	probably benign	0.25
R1639:Ssc5d	UTSW	7	4928417	missense	probably damaging	1.00
R1801:Ssc5d	UTSW	7	4936607	missense	probably benign	0.05
R1867:Ssc5d	UTSW	7	4928507	missense	probably damaging	1.00
R1999:Ssc5d	UTSW	7	4942714	missense	possibly damaging	0.86
R2007:Ssc5d	UTSW	7	4928629	missense	probably damaging	1.00
R2084:Ssc5d	UTSW	7	4937012	missense	probably benign	0.01
R2234:Ssc5d	UTSW	7	4943850	missense	probably benign
R2259:Ssc5d	UTSW	7	4943916	missense	probably benign	0.01
R2567:Ssc5d	UTSW	7	4936335	missense	probably damaging	1.00
R2879:Ssc5d	UTSW	7	4936907	critical splice acceptor site	probably null
R3782:Ssc5d	UTSW	7	4942791	missense	probably benign	0.00
R3875:Ssc5d	UTSW	7	4927262	missense	probably damaging	1.00
R4322:Ssc5d	UTSW	7	4928450	missense	probably damaging	1.00
R4331:Ssc5d	UTSW	7	4942726	missense	probably benign	0.00
R4334:Ssc5d	UTSW	7	4943664	missense	probably benign
R4430:Ssc5d	UTSW	7	4943664	missense	probably benign
R4619:Ssc5d	UTSW	7	4929525	missense	probably damaging	1.00
R4794:Ssc5d	UTSW	7	4943745	missense	probably benign
R5106:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R5174:Ssc5d	UTSW	7	4927971	missense	possibly damaging	0.83
R5553:Ssc5d	UTSW	7	4936290	missense	probably damaging	1.00
R5649:Ssc5d	UTSW	7	4926518	critical splice donor site	probably null
R5786:Ssc5d	UTSW	7	4936818	missense	probably benign	0.00
R6059:Ssc5d	UTSW	7	4942744	missense	possibly damaging	0.86
R6163:Ssc5d	UTSW	7	4927254	missense	probably damaging	1.00
R6332:Ssc5d	UTSW	7	4937522	missense	probably damaging	1.00
R6613:Ssc5d	UTSW	7	4933293	missense	possibly damaging	0.82
R7180:Ssc5d	UTSW	7	4936601	missense	probably benign	0.17
R7576:Ssc5d	UTSW	7	4928573	missense	probably damaging	1.00
R7602:Ssc5d	UTSW	7	4942746	missense	possibly damaging	0.95
R7609:Ssc5d	UTSW	7	4927576	missense	possibly damaging	0.56
R7691:Ssc5d	UTSW	7	4944169	missense	probably benign	0.29
R7759:Ssc5d	UTSW	7	4937530	nonsense	probably null
R8480:Ssc5d	UTSW	7	4936329	missense	probably damaging	1.00
R9029:Ssc5d	UTSW	7	4927920	missense	probably damaging	0.97
R9163:Ssc5d	UTSW	7	4933433	missense	probably damaging	1.00
R9178:Ssc5d	UTSW	7	4927059	missense	probably damaging	1.00
R9181:Ssc5d	UTSW	7	4942815	missense	possibly damaging	0.86
R9382:Ssc5d	UTSW	7	4927284	critical splice donor site	probably null
R9489:Ssc5d	UTSW	7	4937600	missense	probably benign	0.02
R9626:Ssc5d	UTSW	7	4943569	missense	probably benign
R9630:Ssc5d	UTSW	7	4936427	missense	probably damaging	1.00
R9776:Ssc5d	UTSW	7	4929368	missense	probably benign	0.07
X0063:Ssc5d	UTSW	7	4936287	missense	probably damaging	1.00
Z1088:Ssc5d	UTSW	7	4928434	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTCCCAAGAGTACCAAGAAGTGG -3'
(R):5'- TCTACTACTCACCTGATGGCAC -3'

Sequencing Primer
(F):5'- CCTGGGATGCCAACCAC -3'
(R):5'- ACAGGGACTCCAGCAGTTG -3'

Posted On

2018-04-27