Mutagenetix > Incidental Mutation

Incidental Mutation 'R6341:Man2b1'

514394

Institutional Source

Beutler Lab

Gene Symbol

Man2b1

Ensembl Gene

ENSMUSG00000005142

Gene Name

mannosidase 2, alpha B1

Synonyms

lysosomal alpha-mannosidase

MMRRC Submission

044495-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6341 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85083270-85098282 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85095399 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 748 (S748C)

Ref Sequence

ENSEMBL: ENSMUSP00000034121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034121]

AlphaFold

O09159

Predicted Effect

probably damaging
Transcript: ENSMUST00000034121
AA Change: S748C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: S748C

Domain	Start	End	E-Value	Type
low complexity region	40	51	N/A	INTRINSIC
Pfam:Glyco_hydro_38	64	381	2.7e-96	PFAM
Alpha-mann_mid	386	465	4.25e-23	SMART
Pfam:Glyco_hydro_38C	510	1002	6.2e-106	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	T	C	16: 31,105,546	D658G	possibly damaging	Het
Amz2	A	G	11: 109,428,827	H13R	probably benign	Het
Ankrd27	G	T	7: 35,627,403		probably null	Het
Atp8a1	T	C	5: 67,682,927	T704A	possibly damaging	Het
Cabin1	A	T	10: 75,658,739	M1602K	probably damaging	Het
Ccdc74a	T	C	16: 17,648,114	S105P	probably damaging	Het
Cdh26	T	A	2: 178,471,573		probably null	Het
Cxcl10	T	C	5: 92,348,213	I22V	probably benign	Het
Cyp2c68	A	C	19: 39,712,489	V295G	possibly damaging	Het
Ddx10	A	T	9: 53,204,251	D594E	probably benign	Het
Ddx5	T	C	11: 106,785,542		probably null	Het
Ddx58	T	A	4: 40,222,199		probably null	Het
Duox1	T	C	2: 122,337,721	I1109T	probably damaging	Het
Dusp15	T	C	2: 152,946,284		probably null	Het
Ecel1	A	G	1: 87,150,471		probably null	Het
Efcab6	T	G	15: 83,935,938	Q714P	possibly damaging	Het
Erc1	A	G	6: 119,777,998	L464P	possibly damaging	Het
Fam129c	C	T	8: 71,600,077	P65L	probably damaging	Het
Fam234a	T	A	17: 26,213,693	H494L	probably damaging	Het
Gfpt1	T	C	6: 87,088,145	V694A	probably damaging	Het
Gli2	T	C	1: 118,836,224	D1399G	probably damaging	Het
Gm10110	T	C	14: 89,896,708		noncoding transcript	Het
Hdac3	A	G	18: 37,944,164	L219P	probably damaging	Het
Hlcs	A	G	16: 94,231,163	F52S	probably damaging	Het
Ints7	C	A	1: 191,613,127	T643K	probably damaging	Het
Ireb2	A	G	9: 54,908,780	I878M	probably damaging	Het
Itga3	A	T	11: 95,055,851		probably null	Het
Lrfn5	T	A	12: 61,843,582	Y552*	probably null	Het
Mafb	T	C	2: 160,366,451	T76A	probably damaging	Het
Mmp15	G	T	8: 95,365,463		probably null	Het
Mmp17	A	T	5: 129,601,955	R335W	probably damaging	Het
Muc5ac	A	T	7: 141,801,492	D1005V	probably damaging	Het
Myh3	T	C	11: 67,082,996	F165S	probably benign	Het
Nacc1	T	C	8: 84,674,791	D419G	probably benign	Het
Neb	G	A	2: 52,209,474	S4545L	probably damaging	Het
Npas2	T	C	1: 39,300,687	I106T	probably damaging	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr1448	T	C	19: 12,919,479	T277A	probably benign	Het
Pde4dip	T	A	3: 97,694,911	Q2283L	probably benign	Het
Phax	C	T	18: 56,573,101	T21M	possibly damaging	Het
Pitpnm1	A	T	19: 4,102,829	K79*	probably null	Het
Pkd1	T	A	17: 24,580,227	F2807I	probably damaging	Het
Plekha4	C	T	7: 45,541,148	R427C	probably damaging	Het
Ptprj	A	T	2: 90,458,349	F757L	probably benign	Het
Rad1	A	G	15: 10,492,821	D208G	probably damaging	Het
Rangrf	T	A	11: 68,972,712	N156I	probably benign	Het
Rasl11b	T	C	5: 74,198,376	S181P	probably damaging	Het
Rlf	G	A	4: 121,149,360	Q808*	probably null	Het
Rogdi	G	T	16: 5,013,377		probably null	Het
Sec24a	A	T	11: 51,717,776	V573D	probably damaging	Het
Sorbs2	A	G	8: 45,770,578	T200A	probably damaging	Het
Srgap2	C	T	1: 131,291,629	R259H	probably benign	Het
Ssc5d	T	A	7: 4,936,665	V700E	probably benign	Het
Stt3a	A	T	9: 36,751,296	H222Q	probably damaging	Het
Tcaf3	A	T	6: 42,597,259	D6E	possibly damaging	Het
Tdrd12	C	T	7: 35,490,048	R421H	probably damaging	Het
Top3b	T	C	16: 16,879,071	M62T	probably damaging	Het
Trhr	T	G	15: 44,229,298	Y310*	probably null	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp34	A	G	11: 23,381,353	T1085A	probably damaging	Het
Vmn1r179	T	A	7: 23,929,066	H227Q	possibly damaging	Het
Vmn1r31	A	T	6: 58,472,010	M290K	probably benign	Het
Wdr75	T	C	1: 45,802,131		probably null	Het
Wnk1	A	T	6: 119,948,585	V1306D	probably damaging	Het
Xkr4	T	C	1: 3,670,778	T191A	probably benign	Het
Zc3h15	A	G	2: 83,661,223	E265G	probably benign	Het
Zcchc9	A	G	13: 91,800,697	F41S	possibly damaging	Het
Zfp251	T	C	15: 76,854,137	H247R	probably damaging	Het
Zfp433	A	G	10: 81,720,123	E152G	probably damaging	Het
Zfp770	A	T	2: 114,196,759	S276R	probably benign	Het

Other mutations in Man2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00588:Man2b1	APN	8	85084638	splice site	probably null
IGL00671:Man2b1	APN	8	85093938	missense	probably damaging	0.98
IGL01538:Man2b1	APN	8	85097430	missense	probably benign	0.00
dateline	UTSW	8	85084737	missense	probably damaging	1.00
greenwich	UTSW	8	85085456	nonsense	probably null
longitude	UTSW	8	85095144	nonsense	probably null
meridian	UTSW	8	85096752	missense	probably damaging	1.00
R0018:Man2b1	UTSW	8	85097489	missense	probably damaging	1.00
R0302:Man2b1	UTSW	8	85093016	missense	probably damaging	1.00
R0574:Man2b1	UTSW	8	85096776	missense	probably benign
R0727:Man2b1	UTSW	8	85091526	missense	probably damaging	1.00
R0837:Man2b1	UTSW	8	85096829	missense	possibly damaging	0.92
R1087:Man2b1	UTSW	8	85095171	missense	probably damaging	1.00
R1471:Man2b1	UTSW	8	85086845	missense	probably damaging	0.99
R1745:Man2b1	UTSW	8	85093934	missense	probably damaging	1.00
R1903:Man2b1	UTSW	8	85086822	missense	probably damaging	1.00
R2026:Man2b1	UTSW	8	85095335	missense	probably damaging	0.99
R2071:Man2b1	UTSW	8	85085384	missense	possibly damaging	0.90
R2120:Man2b1	UTSW	8	85093024	splice site	probably benign
R3897:Man2b1	UTSW	8	85096948	splice site	probably benign
R3971:Man2b1	UTSW	8	85085391	missense	probably damaging	0.98
R3972:Man2b1	UTSW	8	85085391	missense	probably damaging	0.98
R4096:Man2b1	UTSW	8	85084737	missense	probably damaging	1.00
R4497:Man2b1	UTSW	8	85090936	missense	probably benign	0.22
R5183:Man2b1	UTSW	8	85095784	missense	probably damaging	1.00
R5191:Man2b1	UTSW	8	85084459	missense	probably damaging	1.00
R5644:Man2b1	UTSW	8	85094210	missense	possibly damaging	0.61
R6027:Man2b1	UTSW	8	85096752	missense	probably damaging	1.00
R6291:Man2b1	UTSW	8	85097046	missense	probably benign	0.44
R6467:Man2b1	UTSW	8	85097447	missense	possibly damaging	0.91
R6622:Man2b1	UTSW	8	85084479	missense	probably damaging	1.00
R6624:Man2b1	UTSW	8	85096853	missense	probably benign	0.01
R6631:Man2b1	UTSW	8	85086811	splice site	probably null
R6828:Man2b1	UTSW	8	85086919	missense	possibly damaging	0.88
R6983:Man2b1	UTSW	8	85091071	splice site	probably null
R7159:Man2b1	UTSW	8	85087280	missense	probably benign	0.09
R7267:Man2b1	UTSW	8	85087175	missense	probably damaging	1.00
R7537:Man2b1	UTSW	8	85090965	nonsense	probably null
R7786:Man2b1	UTSW	8	85085456	nonsense	probably null
R8022:Man2b1	UTSW	8	85095613	missense	probably damaging	1.00
R8069:Man2b1	UTSW	8	85097045	missense	probably benign	0.03
R8251:Man2b1	UTSW	8	85095129	missense	probably damaging	0.99
R8406:Man2b1	UTSW	8	85096278	missense	probably damaging	1.00
R8464:Man2b1	UTSW	8	85094143	missense	possibly damaging	0.55
R8701:Man2b1	UTSW	8	85095153	missense	probably damaging	1.00
R8792:Man2b1	UTSW	8	85095144	nonsense	probably null
R8891:Man2b1	UTSW	8	85084455	missense	probably damaging	1.00
R8930:Man2b1	UTSW	8	85095393	missense	probably damaging	1.00
R8932:Man2b1	UTSW	8	85095393	missense	probably damaging	1.00
R8953:Man2b1	UTSW	8	85091910	missense	probably benign	0.36
R9059:Man2b1	UTSW	8	85091526	missense	probably damaging	1.00
Z1176:Man2b1	UTSW	8	85093938	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGATTCGCCTGTACAAAGGAC -3'
(R):5'- TGATTCAATGTCCAGGTGGG -3'

Sequencing Primer
(F):5'- CTGTACAAAGGACAGCGCCATTTG -3'
(R):5'- TCCAGGTGGGTCGATAATCATCC -3'

Posted On

2018-04-27