Incidental Mutation 'R6341:Stt3a'
ID 514397
Institutional Source Beutler Lab
Gene Symbol Stt3a
Ensembl Gene ENSMUSG00000032116
Gene Name STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)
Synonyms Itm1
MMRRC Submission 044495-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R6341 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 36640640-36678918 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36662592 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 222 (H222Q)
Ref Sequence ENSEMBL: ENSMUSP00000113116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120381] [ENSMUST00000128270] [ENSMUST00000217599]
AlphaFold P46978
Predicted Effect probably damaging
Transcript: ENSMUST00000120381
AA Change: H222Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113116
Gene: ENSMUSG00000032116
AA Change: H222Q

DomainStartEndE-ValueType
Pfam:STT3 17 484 2e-163 PFAM
Pfam:PMT_2 97 257 9.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128270
Predicted Effect
SMART Domains Protein: ENSMUSP00000117794
Gene: ENSMUSG00000032116
AA Change: H73Q

DomainStartEndE-ValueType
Pfam:STT3 1 112 1.8e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215998
Predicted Effect probably benign
Transcript: ENSMUST00000217599
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a catalytic subunit of the N-oligosaccharyltransferase (OST) complex, which functions in the endoplasmic reticulum to transfer glycan chains to asparagine residues of target proteins. A separate complex containing a similar catalytic subunit with an overlapping function also exists. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 30,924,364 (GRCm39) D658G possibly damaging Het
Amz2 A G 11: 109,319,653 (GRCm39) H13R probably benign Het
Ankrd27 G T 7: 35,326,828 (GRCm39) probably null Het
Atp8a1 T C 5: 67,840,270 (GRCm39) T704A possibly damaging Het
Cabin1 A T 10: 75,494,573 (GRCm39) M1602K probably damaging Het
Ccdc74a T C 16: 17,465,978 (GRCm39) S105P probably damaging Het
Cdh26 T A 2: 178,113,366 (GRCm39) probably null Het
Cxcl10 T C 5: 92,496,072 (GRCm39) I22V probably benign Het
Cyp2c68 A C 19: 39,700,933 (GRCm39) V295G possibly damaging Het
Ddx10 A T 9: 53,115,551 (GRCm39) D594E probably benign Het
Ddx5 T C 11: 106,676,368 (GRCm39) probably null Het
Duox1 T C 2: 122,168,202 (GRCm39) I1109T probably damaging Het
Dusp15 T C 2: 152,788,204 (GRCm39) probably null Het
Ecel1 A G 1: 87,078,193 (GRCm39) probably null Het
Efcab6 T G 15: 83,820,139 (GRCm39) Q714P possibly damaging Het
Erc1 A G 6: 119,754,959 (GRCm39) L464P possibly damaging Het
Fam234a T A 17: 26,432,667 (GRCm39) H494L probably damaging Het
Gfpt1 T C 6: 87,065,127 (GRCm39) V694A probably damaging Het
Gli2 T C 1: 118,763,954 (GRCm39) D1399G probably damaging Het
Gm10110 T C 14: 90,134,144 (GRCm39) noncoding transcript Het
Hdac3 A G 18: 38,077,217 (GRCm39) L219P probably damaging Het
Hlcs A G 16: 94,032,022 (GRCm39) F52S probably damaging Het
Ints7 C A 1: 191,345,239 (GRCm39) T643K probably damaging Het
Ireb2 A G 9: 54,816,064 (GRCm39) I878M probably damaging Het
Itga3 A T 11: 94,946,677 (GRCm39) probably null Het
Lrfn5 T A 12: 61,890,368 (GRCm39) Y552* probably null Het
Mafb T C 2: 160,208,371 (GRCm39) T76A probably damaging Het
Man2b1 A T 8: 85,822,028 (GRCm39) S748C probably damaging Het
Mmp15 G T 8: 96,092,091 (GRCm39) probably null Het
Mmp17 A T 5: 129,679,019 (GRCm39) R335W probably damaging Het
Muc5ac A T 7: 141,355,229 (GRCm39) D1005V probably damaging Het
Myh3 T C 11: 66,973,822 (GRCm39) F165S probably benign Het
Nacc1 T C 8: 85,401,420 (GRCm39) D419G probably benign Het
Neb G A 2: 52,099,486 (GRCm39) S4545L probably damaging Het
Niban3 C T 8: 72,052,721 (GRCm39) P65L probably damaging Het
Npas2 T C 1: 39,339,768 (GRCm39) I106T probably damaging Het
Ogfrl1 T G 1: 23,408,944 (GRCm39) K427N probably benign Het
Or5b12 T C 19: 12,896,843 (GRCm39) T277A probably benign Het
Pde4dip T A 3: 97,602,227 (GRCm39) Q2283L probably benign Het
Phax C T 18: 56,706,173 (GRCm39) T21M possibly damaging Het
Pitpnm1 A T 19: 4,152,829 (GRCm39) K79* probably null Het
Pkd1 T A 17: 24,799,201 (GRCm39) F2807I probably damaging Het
Plekha4 C T 7: 45,190,572 (GRCm39) R427C probably damaging Het
Ptprj A T 2: 90,288,693 (GRCm39) F757L probably benign Het
Rad1 A G 15: 10,492,907 (GRCm39) D208G probably damaging Het
Rangrf T A 11: 68,863,538 (GRCm39) N156I probably benign Het
Rasl11b T C 5: 74,359,037 (GRCm39) S181P probably damaging Het
Rigi T A 4: 40,222,199 (GRCm39) probably null Het
Rlf G A 4: 121,006,557 (GRCm39) Q808* probably null Het
Rogdi G T 16: 4,831,241 (GRCm39) probably null Het
Sec24a A T 11: 51,608,603 (GRCm39) V573D probably damaging Het
Sorbs2 A G 8: 46,223,615 (GRCm39) T200A probably damaging Het
Srgap2 C T 1: 131,219,367 (GRCm39) R259H probably benign Het
Ssc5d T A 7: 4,939,664 (GRCm39) V700E probably benign Het
Tcaf3 A T 6: 42,574,193 (GRCm39) D6E possibly damaging Het
Tdrd12 C T 7: 35,189,473 (GRCm39) R421H probably damaging Het
Top3b T C 16: 16,696,935 (GRCm39) M62T probably damaging Het
Trhr T G 15: 44,092,694 (GRCm39) Y310* probably null Het
Urb2 G T 8: 124,757,864 (GRCm39) E1190D probably damaging Het
Usp34 A G 11: 23,331,353 (GRCm39) T1085A probably damaging Het
Vmn1r179 T A 7: 23,628,491 (GRCm39) H227Q possibly damaging Het
Vmn1r31 A T 6: 58,448,995 (GRCm39) M290K probably benign Het
Wdr75 T C 1: 45,841,291 (GRCm39) probably null Het
Wnk1 A T 6: 119,925,546 (GRCm39) V1306D probably damaging Het
Xkr4 T C 1: 3,741,001 (GRCm39) T191A probably benign Het
Zc3h15 A G 2: 83,491,567 (GRCm39) E265G probably benign Het
Zcchc9 A G 13: 91,948,816 (GRCm39) F41S possibly damaging Het
Zfp251 T C 15: 76,738,337 (GRCm39) H247R probably damaging Het
Zfp433 A G 10: 81,555,957 (GRCm39) E152G probably damaging Het
Zfp770 A T 2: 114,027,240 (GRCm39) S276R probably benign Het
Other mutations in Stt3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Stt3a APN 9 36,645,662 (GRCm39) missense probably benign 0.00
IGL02237:Stt3a APN 9 36,660,933 (GRCm39) nonsense probably null
IGL02644:Stt3a APN 9 36,663,649 (GRCm39) missense possibly damaging 0.70
IGL02710:Stt3a APN 9 36,670,041 (GRCm39) missense probably damaging 0.99
IGL03085:Stt3a APN 9 36,644,266 (GRCm39) intron probably benign
IGL03180:Stt3a APN 9 36,670,552 (GRCm39) missense probably damaging 1.00
IGL03295:Stt3a APN 9 36,674,627 (GRCm39) splice site probably null
Scramble UTSW 9 36,646,762 (GRCm39) missense probably damaging 1.00
Western UTSW 9 36,646,682 (GRCm39) missense probably damaging 1.00
R0314:Stt3a UTSW 9 36,660,841 (GRCm39) intron probably benign
R0731:Stt3a UTSW 9 36,646,808 (GRCm39) missense probably damaging 1.00
R1188:Stt3a UTSW 9 36,662,636 (GRCm39) missense probably damaging 1.00
R1797:Stt3a UTSW 9 36,654,711 (GRCm39) critical splice donor site probably null
R1846:Stt3a UTSW 9 36,674,681 (GRCm39) missense probably damaging 1.00
R2152:Stt3a UTSW 9 36,659,292 (GRCm39) missense probably damaging 1.00
R2220:Stt3a UTSW 9 36,660,847 (GRCm39) critical splice donor site probably null
R2317:Stt3a UTSW 9 36,659,371 (GRCm39) missense probably benign 0.08
R3689:Stt3a UTSW 9 36,670,618 (GRCm39) missense probably damaging 1.00
R4299:Stt3a UTSW 9 36,674,640 (GRCm39) missense probably damaging 1.00
R4586:Stt3a UTSW 9 36,653,089 (GRCm39) missense probably damaging 1.00
R4595:Stt3a UTSW 9 36,646,808 (GRCm39) missense probably damaging 1.00
R4689:Stt3a UTSW 9 36,644,225 (GRCm39) missense possibly damaging 0.91
R4736:Stt3a UTSW 9 36,661,008 (GRCm39) missense probably benign 0.01
R5145:Stt3a UTSW 9 36,646,762 (GRCm39) missense probably damaging 1.00
R5208:Stt3a UTSW 9 36,657,891 (GRCm39) missense possibly damaging 0.78
R5665:Stt3a UTSW 9 36,670,610 (GRCm39) missense probably damaging 1.00
R5748:Stt3a UTSW 9 36,663,696 (GRCm39) missense probably benign 0.21
R6853:Stt3a UTSW 9 36,653,023 (GRCm39) missense possibly damaging 0.89
R6859:Stt3a UTSW 9 36,646,682 (GRCm39) missense probably damaging 1.00
R7453:Stt3a UTSW 9 36,659,266 (GRCm39) missense possibly damaging 0.91
R7495:Stt3a UTSW 9 36,659,235 (GRCm39) missense probably benign 0.03
R7745:Stt3a UTSW 9 36,662,535 (GRCm39) nonsense probably null
R8007:Stt3a UTSW 9 36,653,065 (GRCm39) missense probably damaging 1.00
R9176:Stt3a UTSW 9 36,662,592 (GRCm39) missense probably damaging 1.00
R9218:Stt3a UTSW 9 36,670,556 (GRCm39) missense probably damaging 0.98
R9552:Stt3a UTSW 9 36,645,675 (GRCm39) missense probably benign 0.00
R9622:Stt3a UTSW 9 36,661,025 (GRCm39) missense possibly damaging 0.95
R9784:Stt3a UTSW 9 36,670,079 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGAAGCCATTCTAAGAAGCTACTC -3'
(R):5'- TCTGTATTACTGTACTTCCTATGGG -3'

Sequencing Primer
(F):5'- GCTACTCAGAAACATTTGGCTGCAG -3'
(R):5'- ACTGTACTTCCTATGGGTATATGTTG -3'
Posted On 2018-04-27