Incidental Mutation 'R6341:Ddx10'
ID514398
Institutional Source Beutler Lab
Gene Symbol Ddx10
Ensembl Gene ENSMUSG00000053289
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Synonyms4632415A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6341 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location53098635-53248053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53204251 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 594 (D594E)
Ref Sequence ENSEMBL: ENSMUSP00000065198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065630]
Predicted Effect probably benign
Transcript: ENSMUST00000065630
AA Change: D594E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065198
Gene: ENSMUSG00000053289
AA Change: D594E

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
DEXDc 88 291 1.74e-53 SMART
HELICc 327 410 8.48e-25 SMART
DUF4217 450 513 6.06e-25 SMART
low complexity region 577 594 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 658 680 N/A INTRINSIC
low complexity region 748 773 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it may be involved in ribosome assembly. Fusion of this gene and the nucleoporin gene, NUP98, by inversion 11 (p15q22) chromosome translocation is found in the patients with de novo or therapy-related myeloid malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit craniofacial defects, including decreased cranium length, cleft palate, and short snout, and show reduced body size, body weight, lean body mass, and bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Ddx10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ddx10 APN 9 53160026 splice site probably benign
IGL01111:Ddx10 APN 9 53159948 missense possibly damaging 0.73
IGL01773:Ddx10 APN 9 53204130 missense possibly damaging 0.94
IGL01837:Ddx10 APN 9 53229198 missense probably benign 0.16
IGL02036:Ddx10 APN 9 53204183 missense probably benign 0.00
IGL02236:Ddx10 APN 9 53235382 missense probably damaging 1.00
IGL02939:Ddx10 APN 9 53204279 missense possibly damaging 0.63
IGL03294:Ddx10 APN 9 53117152 critical splice donor site probably null
R0279:Ddx10 UTSW 9 53235304 missense probably damaging 1.00
R1439:Ddx10 UTSW 9 53240487 missense probably damaging 1.00
R1501:Ddx10 UTSW 9 53233997 missense possibly damaging 0.85
R1529:Ddx10 UTSW 9 53117199 nonsense probably null
R1548:Ddx10 UTSW 9 53149561 critical splice acceptor site probably null
R1717:Ddx10 UTSW 9 53159953 missense probably benign 0.25
R1720:Ddx10 UTSW 9 53238071 missense probably damaging 1.00
R1781:Ddx10 UTSW 9 53207545 missense probably damaging 1.00
R2005:Ddx10 UTSW 9 53240475 critical splice donor site probably null
R2007:Ddx10 UTSW 9 53213278 missense probably benign 0.06
R2073:Ddx10 UTSW 9 53240505 missense probably benign 0.28
R2075:Ddx10 UTSW 9 53240505 missense probably benign 0.28
R2133:Ddx10 UTSW 9 53149512 missense probably benign 0.13
R4660:Ddx10 UTSW 9 53236398 critical splice donor site probably null
R4668:Ddx10 UTSW 9 53099213 missense possibly damaging 0.55
R4706:Ddx10 UTSW 9 53233931 missense probably damaging 1.00
R4814:Ddx10 UTSW 9 53204105 missense possibly damaging 0.54
R5394:Ddx10 UTSW 9 53233857 nonsense probably null
R5655:Ddx10 UTSW 9 53209687 critical splice donor site probably null
R5874:Ddx10 UTSW 9 53229198 missense possibly damaging 0.95
R6534:Ddx10 UTSW 9 53223688 missense probably damaging 1.00
R6801:Ddx10 UTSW 9 53247907 nonsense probably null
R6994:Ddx10 UTSW 9 53204111 missense probably damaging 0.99
R7155:Ddx10 UTSW 9 53117288 missense probably benign 0.00
R7380:Ddx10 UTSW 9 53240486 missense probably damaging 1.00
R7753:Ddx10 UTSW 9 53225604 missense probably damaging 1.00
R8101:Ddx10 UTSW 9 53225520 missense probably damaging 0.98
R8782:Ddx10 UTSW 9 53235288 missense probably damaging 0.99
X0019:Ddx10 UTSW 9 53233996 missense probably damaging 1.00
X0063:Ddx10 UTSW 9 53225573 missense probably damaging 1.00
Z1177:Ddx10 UTSW 9 53204511 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGTTCACTTACCGACAGTGC -3'
(R):5'- AGTCACAGAAGCAGTTCCG -3'

Sequencing Primer
(F):5'- ACCGACAGTGCTTCATTCTCTTTAAG -3'
(R):5'- AGAAGCAGTTCCGCCCAG -3'
Posted On2018-04-27