Mutagenetix > Incidental Mutation

Incidental Mutation 'R6341:Ddx10'

514398

Institutional Source

Beutler Lab

Gene Symbol

Ddx10

Ensembl Gene

ENSMUSG00000053289

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 10

Synonyms

4632415A01Rik

MMRRC Submission

044495-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R6341 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53098635-53248053 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53204251 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 594 (D594E)

Ref Sequence

ENSEMBL: ENSMUSP00000065198 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065630]

AlphaFold

Q80Y44

Predicted Effect

probably benign
Transcript: ENSMUST00000065630
AA Change: D594E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000065198
Gene: ENSMUSG00000053289
AA Change: D594E

Domain	Start	End	E-Value	Type
low complexity region	24	43	N/A	INTRINSIC
DEXDc	88	291	1.74e-53	SMART
HELICc	327	410	8.48e-25	SMART
DUF4217	450	513	6.06e-25	SMART
low complexity region	577	594	N/A	INTRINSIC
low complexity region	627	637	N/A	INTRINSIC
low complexity region	658	680	N/A	INTRINSIC
low complexity region	748	773	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it may be involved in ribosome assembly. Fusion of this gene and the nucleoporin gene, NUP98, by inversion 11 (p15q22) chromosome translocation is found in the patients with de novo or therapy-related myeloid malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit craniofacial defects, including decreased cranium length, cleft palate, and short snout, and show reduced body size, body weight, lean body mass, and bone mineral content. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	T	C	16: 31,105,546	D658G	possibly damaging	Het
Amz2	A	G	11: 109,428,827	H13R	probably benign	Het
Ankrd27	G	T	7: 35,627,403		probably null	Het
Atp8a1	T	C	5: 67,682,927	T704A	possibly damaging	Het
Cabin1	A	T	10: 75,658,739	M1602K	probably damaging	Het
Ccdc74a	T	C	16: 17,648,114	S105P	probably damaging	Het
Cdh26	T	A	2: 178,471,573		probably null	Het
Cxcl10	T	C	5: 92,348,213	I22V	probably benign	Het
Cyp2c68	A	C	19: 39,712,489	V295G	possibly damaging	Het
Ddx5	T	C	11: 106,785,542		probably null	Het
Ddx58	T	A	4: 40,222,199		probably null	Het
Duox1	T	C	2: 122,337,721	I1109T	probably damaging	Het
Dusp15	T	C	2: 152,946,284		probably null	Het
Ecel1	A	G	1: 87,150,471		probably null	Het
Efcab6	T	G	15: 83,935,938	Q714P	possibly damaging	Het
Erc1	A	G	6: 119,777,998	L464P	possibly damaging	Het
Fam129c	C	T	8: 71,600,077	P65L	probably damaging	Het
Fam234a	T	A	17: 26,213,693	H494L	probably damaging	Het
Gfpt1	T	C	6: 87,088,145	V694A	probably damaging	Het
Gli2	T	C	1: 118,836,224	D1399G	probably damaging	Het
Gm10110	T	C	14: 89,896,708		noncoding transcript	Het
Hdac3	A	G	18: 37,944,164	L219P	probably damaging	Het
Hlcs	A	G	16: 94,231,163	F52S	probably damaging	Het
Ints7	C	A	1: 191,613,127	T643K	probably damaging	Het
Ireb2	A	G	9: 54,908,780	I878M	probably damaging	Het
Itga3	A	T	11: 95,055,851		probably null	Het
Lrfn5	T	A	12: 61,843,582	Y552*	probably null	Het
Mafb	T	C	2: 160,366,451	T76A	probably damaging	Het
Man2b1	A	T	8: 85,095,399	S748C	probably damaging	Het
Mmp15	G	T	8: 95,365,463		probably null	Het
Mmp17	A	T	5: 129,601,955	R335W	probably damaging	Het
Muc5ac	A	T	7: 141,801,492	D1005V	probably damaging	Het
Myh3	T	C	11: 67,082,996	F165S	probably benign	Het
Nacc1	T	C	8: 84,674,791	D419G	probably benign	Het
Neb	G	A	2: 52,209,474	S4545L	probably damaging	Het
Npas2	T	C	1: 39,300,687	I106T	probably damaging	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr1448	T	C	19: 12,919,479	T277A	probably benign	Het
Pde4dip	T	A	3: 97,694,911	Q2283L	probably benign	Het
Phax	C	T	18: 56,573,101	T21M	possibly damaging	Het
Pitpnm1	A	T	19: 4,102,829	K79*	probably null	Het
Pkd1	T	A	17: 24,580,227	F2807I	probably damaging	Het
Plekha4	C	T	7: 45,541,148	R427C	probably damaging	Het
Ptprj	A	T	2: 90,458,349	F757L	probably benign	Het
Rad1	A	G	15: 10,492,821	D208G	probably damaging	Het
Rangrf	T	A	11: 68,972,712	N156I	probably benign	Het
Rasl11b	T	C	5: 74,198,376	S181P	probably damaging	Het
Rlf	G	A	4: 121,149,360	Q808*	probably null	Het
Rogdi	G	T	16: 5,013,377		probably null	Het
Sec24a	A	T	11: 51,717,776	V573D	probably damaging	Het
Sorbs2	A	G	8: 45,770,578	T200A	probably damaging	Het
Srgap2	C	T	1: 131,291,629	R259H	probably benign	Het
Ssc5d	T	A	7: 4,936,665	V700E	probably benign	Het
Stt3a	A	T	9: 36,751,296	H222Q	probably damaging	Het
Tcaf3	A	T	6: 42,597,259	D6E	possibly damaging	Het
Tdrd12	C	T	7: 35,490,048	R421H	probably damaging	Het
Top3b	T	C	16: 16,879,071	M62T	probably damaging	Het
Trhr	T	G	15: 44,229,298	Y310*	probably null	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp34	A	G	11: 23,381,353	T1085A	probably damaging	Het
Vmn1r179	T	A	7: 23,929,066	H227Q	possibly damaging	Het
Vmn1r31	A	T	6: 58,472,010	M290K	probably benign	Het
Wdr75	T	C	1: 45,802,131		probably null	Het
Wnk1	A	T	6: 119,948,585	V1306D	probably damaging	Het
Xkr4	T	C	1: 3,670,778	T191A	probably benign	Het
Zc3h15	A	G	2: 83,661,223	E265G	probably benign	Het
Zcchc9	A	G	13: 91,800,697	F41S	possibly damaging	Het
Zfp251	T	C	15: 76,854,137	H247R	probably damaging	Het
Zfp433	A	G	10: 81,720,123	E152G	probably damaging	Het
Zfp770	A	T	2: 114,196,759	S276R	probably benign	Het

Other mutations in Ddx10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00763:Ddx10	APN	9	53160026	splice site	probably benign
IGL01111:Ddx10	APN	9	53159948	missense	possibly damaging	0.73
IGL01773:Ddx10	APN	9	53204130	missense	possibly damaging	0.94
IGL01837:Ddx10	APN	9	53229198	missense	probably benign	0.16
IGL02036:Ddx10	APN	9	53204183	missense	probably benign	0.00
IGL02236:Ddx10	APN	9	53235382	missense	probably damaging	1.00
IGL02939:Ddx10	APN	9	53204279	missense	possibly damaging	0.63
IGL03294:Ddx10	APN	9	53117152	critical splice donor site	probably null
R0279:Ddx10	UTSW	9	53235304	missense	probably damaging	1.00
R1439:Ddx10	UTSW	9	53240487	missense	probably damaging	1.00
R1501:Ddx10	UTSW	9	53233997	missense	possibly damaging	0.85
R1529:Ddx10	UTSW	9	53117199	nonsense	probably null
R1548:Ddx10	UTSW	9	53149561	critical splice acceptor site	probably null
R1717:Ddx10	UTSW	9	53159953	missense	probably benign	0.25
R1720:Ddx10	UTSW	9	53238071	missense	probably damaging	1.00
R1781:Ddx10	UTSW	9	53207545	missense	probably damaging	1.00
R2005:Ddx10	UTSW	9	53240475	critical splice donor site	probably null
R2007:Ddx10	UTSW	9	53213278	missense	probably benign	0.06
R2073:Ddx10	UTSW	9	53240505	missense	probably benign	0.28
R2075:Ddx10	UTSW	9	53240505	missense	probably benign	0.28
R2133:Ddx10	UTSW	9	53149512	missense	probably benign	0.13
R4660:Ddx10	UTSW	9	53236398	critical splice donor site	probably null
R4668:Ddx10	UTSW	9	53099213	missense	possibly damaging	0.55
R4706:Ddx10	UTSW	9	53233931	missense	probably damaging	1.00
R4814:Ddx10	UTSW	9	53204105	missense	possibly damaging	0.54
R5394:Ddx10	UTSW	9	53233857	nonsense	probably null
R5655:Ddx10	UTSW	9	53209687	critical splice donor site	probably null
R5874:Ddx10	UTSW	9	53229198	missense	possibly damaging	0.95
R6534:Ddx10	UTSW	9	53223688	missense	probably damaging	1.00
R6801:Ddx10	UTSW	9	53247907	nonsense	probably null
R6994:Ddx10	UTSW	9	53204111	missense	probably damaging	0.99
R7155:Ddx10	UTSW	9	53117288	missense	probably benign	0.00
R7380:Ddx10	UTSW	9	53240486	missense	probably damaging	1.00
R7753:Ddx10	UTSW	9	53225604	missense	probably damaging	1.00
R8101:Ddx10	UTSW	9	53225520	missense	probably damaging	0.98
R8782:Ddx10	UTSW	9	53235288	missense	probably damaging	0.99
R8962:Ddx10	UTSW	9	53238077	missense	probably damaging	1.00
R8998:Ddx10	UTSW	9	53229234	missense	possibly damaging	0.64
R8999:Ddx10	UTSW	9	53229234	missense	possibly damaging	0.64
R9283:Ddx10	UTSW	9	53235356	missense	probably benign	0.01
X0019:Ddx10	UTSW	9	53233996	missense	probably damaging	1.00
X0063:Ddx10	UTSW	9	53225573	missense	probably damaging	1.00
Z1177:Ddx10	UTSW	9	53204511	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GAGTTCACTTACCGACAGTGC -3'
(R):5'- AGTCACAGAAGCAGTTCCG -3'

Sequencing Primer
(F):5'- ACCGACAGTGCTTCATTCTCTTTAAG -3'
(R):5'- AGAAGCAGTTCCGCCCAG -3'

Posted On

2018-04-27