Incidental Mutation 'R6341:Cabin1'
ID514400
Institutional Source Beutler Lab
Gene Symbol Cabin1
Ensembl Gene ENSMUSG00000020196
Gene Namecalcineurin binding protein 1
SynonymsCain, Ppp3in, A330070M20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6341 (G1)
Quality Score142.008
Status Not validated
Chromosome10
Chromosomal Location75646112-75764341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75658739 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1602 (M1602K)
Ref Sequence ENSEMBL: ENSMUSP00000001712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001712]
Predicted Effect probably damaging
Transcript: ENSMUST00000001712
AA Change: M1602K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001712
Gene: ENSMUSG00000020196
AA Change: M1602K

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
TPR 90 123 4.15e-2 SMART
TPR 124 157 5.69e0 SMART
low complexity region 312 326 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
TPR 615 648 9.7e0 SMART
low complexity region 740 750 N/A INTRINSIC
low complexity region 882 892 N/A INTRINSIC
TPR 1055 1088 6.92e1 SMART
low complexity region 1327 1349 N/A INTRINSIC
low complexity region 1714 1727 N/A INTRINSIC
low complexity region 1778 1790 N/A INTRINSIC
low complexity region 1791 1803 N/A INTRINSIC
low complexity region 1810 1831 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Pfam:MEF2_binding 2123 2157 5.7e-26 PFAM
low complexity region 2165 2183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218814
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin plays an important role in the T-cell receptor-mediated signal transduction pathway. The protein encoded by this gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The encoded protein is found in the nucleus and contains a leucine zipper domain as well as several PEST motifs, sequences which confer targeted degradation to those proteins which contain them. Alternative splicing results in multiple transcript variants encoding two different isoforms. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mutants exhibit embryonic lethality during organogenesis. Mice producing a truncated protein exhibit elevated levels of serum IgG1, IgG2b and IgE, produce more IgG1 in response to T-cell dependent antigen, and have enhanced expression of cytokines in response to anti-CD3 stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Cabin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Cabin1 APN 10 75725586 missense possibly damaging 0.58
IGL01457:Cabin1 APN 10 75742429 missense probably damaging 0.96
IGL02217:Cabin1 APN 10 75700047 missense possibly damaging 0.95
IGL02649:Cabin1 APN 10 75737418 missense probably damaging 1.00
IGL02737:Cabin1 APN 10 75713585 missense probably benign 0.09
IGL02792:Cabin1 APN 10 75746739 missense probably damaging 1.00
IGL03047:Cabin1 APN 10 75700100 splice site probably benign
IGL03106:Cabin1 APN 10 75733628 missense probably benign 0.01
IGL03276:Cabin1 APN 10 75732413 missense probably damaging 1.00
bison UTSW 10 75684323 missense probably damaging 1.00
range UTSW 10 75658647 missense probably damaging 1.00
R0335:Cabin1 UTSW 10 75657049 missense probably damaging 1.00
R0557:Cabin1 UTSW 10 75726917 missense probably damaging 1.00
R0578:Cabin1 UTSW 10 75713610 missense probably damaging 0.96
R0588:Cabin1 UTSW 10 75745337 missense possibly damaging 0.71
R1115:Cabin1 UTSW 10 75717677 missense possibly damaging 0.70
R1120:Cabin1 UTSW 10 75725716 missense probably damaging 1.00
R1439:Cabin1 UTSW 10 75656806 missense probably damaging 1.00
R1471:Cabin1 UTSW 10 75694792 missense probably damaging 1.00
R1794:Cabin1 UTSW 10 75725745 missense possibly damaging 0.52
R1844:Cabin1 UTSW 10 75743350 splice site probably null
R1959:Cabin1 UTSW 10 75735090 missense possibly damaging 0.92
R2008:Cabin1 UTSW 10 75734976 splice site probably null
R2279:Cabin1 UTSW 10 75753461 missense probably benign
R3150:Cabin1 UTSW 10 75656911 missense probably damaging 1.00
R3929:Cabin1 UTSW 10 75751618 critical splice acceptor site probably null
R3945:Cabin1 UTSW 10 75745259 missense probably damaging 1.00
R3946:Cabin1 UTSW 10 75745259 missense probably damaging 1.00
R4206:Cabin1 UTSW 10 75754841 missense possibly damaging 0.69
R4812:Cabin1 UTSW 10 75646594 missense possibly damaging 0.93
R4944:Cabin1 UTSW 10 75721363 missense probably damaging 1.00
R4944:Cabin1 UTSW 10 75739421 missense probably damaging 0.99
R5078:Cabin1 UTSW 10 75721478 missense probably damaging 1.00
R5082:Cabin1 UTSW 10 75738330 missense probably damaging 0.99
R5319:Cabin1 UTSW 10 75725715 missense probably damaging 1.00
R5481:Cabin1 UTSW 10 75735066 missense probably benign 0.29
R5504:Cabin1 UTSW 10 75653009 missense probably benign 0.00
R5710:Cabin1 UTSW 10 75647018 missense probably benign 0.00
R5908:Cabin1 UTSW 10 75721532 missense probably damaging 1.00
R5975:Cabin1 UTSW 10 75657839 missense probably damaging 1.00
R5982:Cabin1 UTSW 10 75725560 missense probably benign 0.00
R6038:Cabin1 UTSW 10 75739366 missense probably benign 0.02
R6038:Cabin1 UTSW 10 75739366 missense probably benign 0.02
R6114:Cabin1 UTSW 10 75747971 missense probably benign 0.00
R6285:Cabin1 UTSW 10 75684323 missense probably damaging 1.00
R6361:Cabin1 UTSW 10 75726865 missense possibly damaging 0.91
R6395:Cabin1 UTSW 10 75746742 missense probably benign 0.10
R6422:Cabin1 UTSW 10 75656792 missense probably damaging 1.00
R6575:Cabin1 UTSW 10 75725701 missense possibly damaging 0.90
R6763:Cabin1 UTSW 10 75746730 missense probably damaging 0.99
R6845:Cabin1 UTSW 10 75721508 missense probably damaging 1.00
R6936:Cabin1 UTSW 10 75715758 splice site probably null
R7050:Cabin1 UTSW 10 75713542 missense probably damaging 1.00
R7055:Cabin1 UTSW 10 75743283 missense probably benign 0.04
R7101:Cabin1 UTSW 10 75751567 missense probably benign
R7138:Cabin1 UTSW 10 75745353 missense probably damaging 0.98
R7173:Cabin1 UTSW 10 75746562 missense probably benign 0.00
R7265:Cabin1 UTSW 10 75721423 missense
R7284:Cabin1 UTSW 10 75694834 missense
R7472:Cabin1 UTSW 10 75658647 missense probably damaging 1.00
R7571:Cabin1 UTSW 10 75646666 missense probably damaging 1.00
R7617:Cabin1 UTSW 10 75732443 missense possibly damaging 0.85
R7739:Cabin1 UTSW 10 75658658 missense probably damaging 1.00
R7997:Cabin1 UTSW 10 75733775 missense probably benign 0.01
R8347:Cabin1 UTSW 10 75742367 missense probably damaging 0.98
R8544:Cabin1 UTSW 10 75750056 missense probably benign 0.17
R8546:Cabin1 UTSW 10 75742267 missense probably damaging 1.00
R8692:Cabin1 UTSW 10 75751576 missense probably benign 0.28
Z1177:Cabin1 UTSW 10 75648123 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGAGATGTCCCTCAGGAGTG -3'
(R):5'- CTGGCTAGGTCCTATGCATAG -3'

Sequencing Primer
(F):5'- CTGGGACTTCTGGACCAATAGAC -3'
(R):5'- TAGTGGCAAGCTTGAGAGGACTTC -3'
Posted On2018-04-27