Incidental Mutation 'R6341:Zfp433'
ID514401
Institutional Source Beutler Lab
Gene Symbol Zfp433
Ensembl Gene ENSMUSG00000096795
Gene Namezinc finger protein 433
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R6341 (G1)
Quality Score149.008
Status Not validated
Chromosome10
Chromosomal Location81704825-81726686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81720123 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 152 (E152G)
Ref Sequence ENSEMBL: ENSMUSP00000082807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085664] [ENSMUST00000200889] [ENSMUST00000201819]
Predicted Effect probably damaging
Transcript: ENSMUST00000085664
AA Change: E152G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082807
Gene: ENSMUSG00000096795
AA Change: E152G

DomainStartEndE-ValueType
KRAB 3 65 2.34e-15 SMART
ZnF_C2H2 105 127 1.18e-2 SMART
ZnF_C2H2 133 155 2.43e-4 SMART
ZnF_C2H2 161 183 1.6e-4 SMART
ZnF_C2H2 189 211 2.09e-3 SMART
ZnF_C2H2 217 239 1.26e-2 SMART
ZnF_C2H2 245 267 3.69e-4 SMART
ZnF_C2H2 273 295 4.87e-4 SMART
ZnF_C2H2 301 323 8.34e-3 SMART
ZnF_C2H2 329 351 8.34e-3 SMART
ZnF_C2H2 357 379 3.78e-1 SMART
ZnF_C2H2 385 407 2.36e-2 SMART
ZnF_C2H2 413 435 1.69e-3 SMART
ZnF_C2H2 441 463 5.9e-3 SMART
ZnF_C2H2 469 491 2.99e-4 SMART
ZnF_C2H2 497 519 8.94e-3 SMART
ZnF_C2H2 525 547 1.6e-4 SMART
ZnF_C2H2 553 575 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200889
AA Change: E153G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144123
Gene: ENSMUSG00000096795
AA Change: E153G

DomainStartEndE-ValueType
KRAB 4 66 9.8e-18 SMART
ZnF_C2H2 106 128 5.1e-5 SMART
ZnF_C2H2 134 156 1e-6 SMART
ZnF_C2H2 162 184 7.1e-7 SMART
ZnF_C2H2 190 212 8.8e-6 SMART
ZnF_C2H2 218 240 5.4e-5 SMART
ZnF_C2H2 246 268 1.6e-6 SMART
ZnF_C2H2 274 296 2e-6 SMART
ZnF_C2H2 302 324 3.7e-5 SMART
ZnF_C2H2 330 352 3.7e-5 SMART
ZnF_C2H2 358 380 1.6e-3 SMART
ZnF_C2H2 386 408 1e-4 SMART
ZnF_C2H2 414 436 7.4e-6 SMART
ZnF_C2H2 442 464 2.6e-5 SMART
ZnF_C2H2 470 492 1.3e-6 SMART
ZnF_C2H2 498 520 3.9e-5 SMART
ZnF_C2H2 526 548 7e-7 SMART
ZnF_C2H2 554 576 2.3e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201114
Predicted Effect probably benign
Transcript: ENSMUST00000201819
AA Change: E121G

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144100
Gene: ENSMUSG00000096795
AA Change: E121G

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-17 BLAST
ZnF_C2H2 74 96 5.1e-5 SMART
ZnF_C2H2 102 124 1e-6 SMART
ZnF_C2H2 130 152 7.1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219225
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Zfp433
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4238:Zfp433 UTSW 10 81720212 missense probably damaging 0.99
R5574:Zfp433 UTSW 10 81719291 nonsense probably null
R6480:Zfp433 UTSW 10 81720244 missense possibly damaging 0.73
R6681:Zfp433 UTSW 10 81720888 missense probably damaging 1.00
R7142:Zfp433 UTSW 10 81720206 nonsense probably null
R7382:Zfp433 UTSW 10 81720825 missense probably benign 0.11
R8058:Zfp433 UTSW 10 81720290 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTGTGTGTATGCAGTGTGAAAC -3'
(R):5'- TCATAAGGTTTCTCTCCAGTGTG -3'

Sequencing Primer
(F):5'- TACAAGCCTTGTGAGCATAAGGG -3'
(R):5'- TTTGAAGATGACTGCGACATGC -3'
Posted On2018-04-27