Incidental Mutation 'R6341:Zfp433'
ID 514401
Institutional Source Beutler Lab
Gene Symbol Zfp433
Ensembl Gene ENSMUSG00000096795
Gene Name zinc finger protein 433
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock # R6341 (G1)
Quality Score 149.008
Status Not validated
Chromosome 10
Chromosomal Location 81704825-81726686 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81720123 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 152 (E152G)
Ref Sequence ENSEMBL: ENSMUSP00000082807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085664] [ENSMUST00000200889] [ENSMUST00000201819]
AlphaFold A0A0J9YUD4
Predicted Effect probably damaging
Transcript: ENSMUST00000085664
AA Change: E152G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082807
Gene: ENSMUSG00000096795
AA Change: E152G

DomainStartEndE-ValueType
KRAB 3 65 2.34e-15 SMART
ZnF_C2H2 105 127 1.18e-2 SMART
ZnF_C2H2 133 155 2.43e-4 SMART
ZnF_C2H2 161 183 1.6e-4 SMART
ZnF_C2H2 189 211 2.09e-3 SMART
ZnF_C2H2 217 239 1.26e-2 SMART
ZnF_C2H2 245 267 3.69e-4 SMART
ZnF_C2H2 273 295 4.87e-4 SMART
ZnF_C2H2 301 323 8.34e-3 SMART
ZnF_C2H2 329 351 8.34e-3 SMART
ZnF_C2H2 357 379 3.78e-1 SMART
ZnF_C2H2 385 407 2.36e-2 SMART
ZnF_C2H2 413 435 1.69e-3 SMART
ZnF_C2H2 441 463 5.9e-3 SMART
ZnF_C2H2 469 491 2.99e-4 SMART
ZnF_C2H2 497 519 8.94e-3 SMART
ZnF_C2H2 525 547 1.6e-4 SMART
ZnF_C2H2 553 575 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200889
AA Change: E153G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144123
Gene: ENSMUSG00000096795
AA Change: E153G

DomainStartEndE-ValueType
KRAB 4 66 9.8e-18 SMART
ZnF_C2H2 106 128 5.1e-5 SMART
ZnF_C2H2 134 156 1e-6 SMART
ZnF_C2H2 162 184 7.1e-7 SMART
ZnF_C2H2 190 212 8.8e-6 SMART
ZnF_C2H2 218 240 5.4e-5 SMART
ZnF_C2H2 246 268 1.6e-6 SMART
ZnF_C2H2 274 296 2e-6 SMART
ZnF_C2H2 302 324 3.7e-5 SMART
ZnF_C2H2 330 352 3.7e-5 SMART
ZnF_C2H2 358 380 1.6e-3 SMART
ZnF_C2H2 386 408 1e-4 SMART
ZnF_C2H2 414 436 7.4e-6 SMART
ZnF_C2H2 442 464 2.6e-5 SMART
ZnF_C2H2 470 492 1.3e-6 SMART
ZnF_C2H2 498 520 3.9e-5 SMART
ZnF_C2H2 526 548 7e-7 SMART
ZnF_C2H2 554 576 2.3e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201114
Predicted Effect probably benign
Transcript: ENSMUST00000201819
AA Change: E121G

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144100
Gene: ENSMUSG00000096795
AA Change: E121G

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-17 BLAST
ZnF_C2H2 74 96 5.1e-5 SMART
ZnF_C2H2 102 124 1e-6 SMART
ZnF_C2H2 130 152 7.1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219225
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Zfp433
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4238:Zfp433 UTSW 10 81720212 missense probably damaging 0.99
R5574:Zfp433 UTSW 10 81719291 nonsense probably null
R6480:Zfp433 UTSW 10 81720244 missense possibly damaging 0.73
R6681:Zfp433 UTSW 10 81720888 missense probably damaging 1.00
R7142:Zfp433 UTSW 10 81720206 nonsense probably null
R7382:Zfp433 UTSW 10 81720825 missense probably benign 0.11
R8058:Zfp433 UTSW 10 81720290 nonsense probably null
R8849:Zfp433 UTSW 10 81721041 missense probably benign 0.09
R9129:Zfp433 UTSW 10 81719890 nonsense probably null
R9293:Zfp433 UTSW 10 81720288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGTGTATGCAGTGTGAAAC -3'
(R):5'- TCATAAGGTTTCTCTCCAGTGTG -3'

Sequencing Primer
(F):5'- TACAAGCCTTGTGAGCATAAGGG -3'
(R):5'- TTTGAAGATGACTGCGACATGC -3'
Posted On 2018-04-27