Incidental Mutation 'R6341:Ddx5'
ID514407
Institutional Source Beutler Lab
Gene Symbol Ddx5
Ensembl Gene ENSMUSG00000020719
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 5
SynonymsHlr1, p68, 2600009A06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6341 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106780355-106789185 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 106785542 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018516] [ENSMUST00000021062] [ENSMUST00000103068] [ENSMUST00000123339] [ENSMUST00000127481] [ENSMUST00000129585] [ENSMUST00000133426]
Predicted Effect probably benign
Transcript: ENSMUST00000018516
SMART Domains Protein: ENSMUSP00000018516
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
low complexity region 389 407 N/A INTRINSIC
coiled coil region 584 633 N/A INTRINSIC
coiled coil region 701 793 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000021062
SMART Domains Protein: ENSMUSP00000021062
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 9e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
HELICc 355 436 3.57e-32 SMART
low complexity region 477 496 N/A INTRINSIC
Pfam:P68HR 498 532 8e-20 PFAM
Pfam:P68HR 551 583 5.2e-20 PFAM
low complexity region 592 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103068
SMART Domains Protein: ENSMUSP00000099357
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
low complexity region 346 364 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
coiled coil region 658 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106779
SMART Domains Protein: ENSMUSP00000102391
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 3e-38 BLAST
PDB:4A4D|A 52 86 4e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000123339
SMART Domains Protein: ENSMUSP00000121733
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 7e-37 BLAST
Pfam:DEAD 118 161 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127481
SMART Domains Protein: ENSMUSP00000138184
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 70 2e-26 BLAST
PDB:4A4D|A 52 70 3e-7 PDB
Predicted Effect probably null
Transcript: ENSMUST00000129585
SMART Domains Protein: ENSMUSP00000116859
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 8e-37 BLAST
Pfam:DEAD 118 183 7.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130172
Predicted Effect probably benign
Transcript: ENSMUST00000133426
SMART Domains Protein: ENSMUSP00000138237
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 2e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
Pfam:Helicase_C 359 406 1.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175532
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter/null allele die around E11.5 displaying blood vessel malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Ddx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Ddx5 APN 11 106785009 missense probably damaging 0.99
IGL02975:Ddx5 APN 11 106781885 missense probably benign 0.00
IGL03037:Ddx5 APN 11 106782104 missense possibly damaging 0.82
IGL03046:Ddx5 UTSW 11 106785045 missense probably damaging 1.00
R0544:Ddx5 UTSW 11 106782462 unclassified probably benign
R1186:Ddx5 UTSW 11 106783979 splice site probably null
R1464:Ddx5 UTSW 11 106784885 missense probably benign 0.00
R1464:Ddx5 UTSW 11 106784885 missense probably benign 0.00
R1839:Ddx5 UTSW 11 106784897 missense probably benign 0.02
R3781:Ddx5 UTSW 11 106784520 missense probably benign 0.00
R3782:Ddx5 UTSW 11 106784520 missense probably benign 0.00
R4968:Ddx5 UTSW 11 106784127 missense probably damaging 1.00
R4973:Ddx5 UTSW 11 106785007 missense possibly damaging 0.94
R4995:Ddx5 UTSW 11 106785236 missense probably damaging 1.00
R5839:Ddx5 UTSW 11 106782206 missense probably damaging 0.97
R6263:Ddx5 UTSW 11 106788313 missense possibly damaging 0.83
R6314:Ddx5 UTSW 11 106788521 unclassified probably benign
R6707:Ddx5 UTSW 11 106782232 missense probably benign 0.00
R7424:Ddx5 UTSW 11 106782180 missense probably benign 0.12
R7910:Ddx5 UTSW 11 106784435 missense probably damaging 1.00
R8145:Ddx5 UTSW 11 106782085 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTCCATCAGTGACAAAGATCC -3'
(R):5'- ACAAGGAGAGACCAACTTGC -3'

Sequencing Primer
(F):5'- GTGACAAAGATCCCCCTTTATGG -3'
(R):5'- AAAAGTTGCCTTCTGGTTTCTCCATG -3'
Posted On2018-04-27