Mutagenetix > Incidental Mutations

Incidental Mutation 'R6341:Lrfn5'

514409

Institutional Source

Beutler Lab

Gene Symbol

Lrfn5

Ensembl Gene

ENSMUSG00000035653

Gene Name

leucine rich repeat and fibronectin type III domain containing 5

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R6341 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

61523150-61858342 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 61843582 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 552 (Y552*)

Ref Sequence

ENSEMBL: ENSMUSP00000113123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055815] [ENSMUST00000119481]

Predicted Effect

probably null
Transcript: ENSMUST00000055815
AA Change: Y552*

SMART Domains

Protein: ENSMUSP00000051546
Gene: ENSMUSG00000035653
AA Change: Y552*

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
LRRNT	19	55	1.11e1	SMART
LRR	74	97	3.07e-1	SMART
LRR_TYP	98	121	1.2e-3	SMART
LRR_TYP	122	145	8.94e-3	SMART
LRR	146	169	6.58e0	SMART
LRR_TYP	170	193	8.34e-3	SMART
LRR	194	218	2.47e1	SMART
LRRCT	240	285	1.65e-2	SMART
IGc2	299	364	3.53e-13	SMART
low complexity region	393	412	N/A	INTRINSIC
Blast:FN3	414	495	2e-48	BLAST
transmembrane domain	528	550	N/A	INTRINSIC
low complexity region	613	627	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000119481
AA Change: Y552*

SMART Domains

Protein: ENSMUSP00000113123
Gene: ENSMUSG00000035653
AA Change: Y552*

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
LRRNT	19	55	1.11e1	SMART
LRR	74	97	3.07e-1	SMART
LRR_TYP	98	121	1.2e-3	SMART
LRR_TYP	122	145	8.94e-3	SMART
LRR	146	169	6.58e0	SMART
LRR_TYP	170	193	8.34e-3	SMART
LRR	194	218	2.47e1	SMART
LRRCT	240	285	1.65e-2	SMART
IGc2	299	364	3.53e-13	SMART
low complexity region	393	412	N/A	INTRINSIC
Blast:FN3	414	495	2e-48	BLAST
transmembrane domain	528	550	N/A	INTRINSIC
low complexity region	613	627	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the leucine-rich repeat and fibronectin type III domain-containing family of proteins. A similar protein in mouse, a glycosylated transmembrane protein, is thought to function in presynaptic differentiation. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	T	C	16: 31,105,546	D658G	possibly damaging	Het
Amz2	A	G	11: 109,428,827	H13R	probably benign	Het
Ankrd27	G	T	7: 35,627,403		probably null	Het
Atp8a1	T	C	5: 67,682,927	T704A	possibly damaging	Het
Cabin1	A	T	10: 75,658,739	M1602K	probably damaging	Het
Ccdc74a	T	C	16: 17,648,114	S105P	probably damaging	Het
Cdh26	T	A	2: 178,471,573		probably null	Het
Cxcl10	T	C	5: 92,348,213	I22V	probably benign	Het
Cyp2c68	A	C	19: 39,712,489	V295G	possibly damaging	Het
Ddx10	A	T	9: 53,204,251	D594E	probably benign	Het
Ddx5	T	C	11: 106,785,542		probably null	Het
Ddx58	T	A	4: 40,222,199		probably null	Het
Duox1	T	C	2: 122,337,721	I1109T	probably damaging	Het
Dusp15	T	C	2: 152,946,284		probably null	Het
Ecel1	A	G	1: 87,150,471		probably null	Het
Efcab6	T	G	15: 83,935,938	Q714P	possibly damaging	Het
Erc1	A	G	6: 119,777,998	L464P	possibly damaging	Het
Fam129c	C	T	8: 71,600,077	P65L	probably damaging	Het
Fam234a	T	A	17: 26,213,693	H494L	probably damaging	Het
Gfpt1	T	C	6: 87,088,145	V694A	probably damaging	Het
Gli2	T	C	1: 118,836,224	D1399G	probably damaging	Het
Gm10110	T	C	14: 89,896,708		noncoding transcript	Het
Hdac3	A	G	18: 37,944,164	L219P	probably damaging	Het
Hlcs	A	G	16: 94,231,163	F52S	probably damaging	Het
Ints7	C	A	1: 191,613,127	T643K	probably damaging	Het
Ireb2	A	G	9: 54,908,780	I878M	probably damaging	Het
Itga3	A	T	11: 95,055,851		probably null	Het
Mafb	T	C	2: 160,366,451	T76A	probably damaging	Het
Man2b1	A	T	8: 85,095,399	S748C	probably damaging	Het
Mmp15	G	T	8: 95,365,463		probably null	Het
Mmp17	A	T	5: 129,601,955	R335W	probably damaging	Het
Muc5ac	A	T	7: 141,801,492	D1005V	probably damaging	Het
Myh3	T	C	11: 67,082,996	F165S	probably benign	Het
Nacc1	T	C	8: 84,674,791	D419G	probably benign	Het
Neb	G	A	2: 52,209,474	S4545L	probably damaging	Het
Npas2	T	C	1: 39,300,687	I106T	probably damaging	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr1448	T	C	19: 12,919,479	T277A	probably benign	Het
Pde4dip	T	A	3: 97,694,911	Q2283L	probably benign	Het
Phax	C	T	18: 56,573,101	T21M	possibly damaging	Het
Pitpnm1	A	T	19: 4,102,829	K79*	probably null	Het
Pkd1	T	A	17: 24,580,227	F2807I	probably damaging	Het
Plekha4	C	T	7: 45,541,148	R427C	probably damaging	Het
Ptprj	A	T	2: 90,458,349	F757L	probably benign	Het
Rad1	A	G	15: 10,492,821	D208G	probably damaging	Het
Rangrf	T	A	11: 68,972,712	N156I	probably benign	Het
Rasl11b	T	C	5: 74,198,376	S181P	probably damaging	Het
Rlf	G	A	4: 121,149,360	Q808*	probably null	Het
Rogdi	G	T	16: 5,013,377		probably null	Het
Sec24a	A	T	11: 51,717,776	V573D	probably damaging	Het
Sorbs2	A	G	8: 45,770,578	T200A	probably damaging	Het
Srgap2	C	T	1: 131,291,629	R259H	probably benign	Het
Ssc5d	T	A	7: 4,936,665	V700E	probably benign	Het
Stt3a	A	T	9: 36,751,296	H222Q	probably damaging	Het
Tcaf3	A	T	6: 42,597,259	D6E	possibly damaging	Het
Tdrd12	C	T	7: 35,490,048	R421H	probably damaging	Het
Top3b	T	C	16: 16,879,071	M62T	probably damaging	Het
Trhr	T	G	15: 44,229,298	Y310*	probably null	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp34	A	G	11: 23,381,353	T1085A	probably damaging	Het
Vmn1r179	T	A	7: 23,929,066	H227Q	possibly damaging	Het
Vmn1r31	A	T	6: 58,472,010	M290K	probably benign	Het
Wdr75	T	C	1: 45,802,131		probably null	Het
Wnk1	A	T	6: 119,948,585	V1306D	probably damaging	Het
Xkr4	T	C	1: 3,670,778	T191A	probably benign	Het
Zc3h15	A	G	2: 83,661,223	E265G	probably benign	Het
Zcchc9	A	G	13: 91,800,697	F41S	possibly damaging	Het
Zfp251	T	C	15: 76,854,137	H247R	probably damaging	Het
Zfp433	A	G	10: 81,720,123	E152G	probably damaging	Het
Zfp770	A	T	2: 114,196,759	S276R	probably benign	Het

Other mutations in Lrfn5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Lrfn5	APN	12	61844126	missense	probably benign
IGL02010:Lrfn5	APN	12	61839683	missense	probably damaging	0.96
IGL03033:Lrfn5	APN	12	61840047	missense	probably damaging	1.00
IGL03094:Lrfn5	APN	12	61839746	missense	probably benign	0.00
IGL03207:Lrfn5	APN	12	61843326	missense	probably damaging	1.00
falstaffian	UTSW	12	61843562	missense	probably benign	0.21
PIT4696001:Lrfn5	UTSW	12	61843557	missense	probably damaging	1.00
R0402:Lrfn5	UTSW	12	61840017	missense	probably benign	0.22
R0738:Lrfn5	UTSW	12	61840592	nonsense	probably null
R0744:Lrfn5	UTSW	12	61839668	missense	probably damaging	1.00
R0833:Lrfn5	UTSW	12	61839668	missense	probably damaging	1.00
R0973:Lrfn5	UTSW	12	61843437	missense	probably damaging	1.00
R0973:Lrfn5	UTSW	12	61843437	missense	probably damaging	1.00
R0974:Lrfn5	UTSW	12	61843437	missense	probably damaging	1.00
R1073:Lrfn5	UTSW	12	61840809	missense	probably damaging	1.00
R1332:Lrfn5	UTSW	12	61857528	splice site	probably benign
R1500:Lrfn5	UTSW	12	61839741	missense	probably damaging	1.00
R2039:Lrfn5	UTSW	12	61840323	missense	possibly damaging	0.82
R3834:Lrfn5	UTSW	12	61840030	missense	probably damaging	1.00
R4171:Lrfn5	UTSW	12	61843382	missense	probably damaging	1.00
R4212:Lrfn5	UTSW	12	61843820	missense	probably benign
R4394:Lrfn5	UTSW	12	61843490	missense	probably damaging	1.00
R4578:Lrfn5	UTSW	12	61843977	missense	probably benign
R4661:Lrfn5	UTSW	12	61839647	missense	probably damaging	1.00
R4730:Lrfn5	UTSW	12	61840719	missense	probably benign	0.03
R4955:Lrfn5	UTSW	12	61839978	missense	probably benign	0.29
R4968:Lrfn5	UTSW	12	61839675	missense	probably damaging	1.00
R4970:Lrfn5	UTSW	12	61839675	missense	probably damaging	1.00
R5078:Lrfn5	UTSW	12	61843874	missense	possibly damaging	0.47
R5165:Lrfn5	UTSW	12	61839624	missense	possibly damaging	0.89
R5768:Lrfn5	UTSW	12	61839723	missense	probably benign	0.44
R5892:Lrfn5	UTSW	12	61843418	missense	probably damaging	1.00
R6133:Lrfn5	UTSW	12	61843788	missense	probably benign	0.22
R6211:Lrfn5	UTSW	12	61839470	missense	probably benign	0.00
R6297:Lrfn5	UTSW	12	61843562	missense	probably benign	0.21
R6861:Lrfn5	UTSW	12	61839690	missense	probably damaging	1.00
R7179:Lrfn5	UTSW	12	61843982	missense	probably benign
R7392:Lrfn5	UTSW	12	61840304	missense	probably benign	0.00
R8224:Lrfn5	UTSW	12	61843406	missense	possibly damaging	0.91
R8261:Lrfn5	UTSW	12	61839537	missense	probably damaging	1.00
Z1177:Lrfn5	UTSW	12	61839817	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTCAATAATCTGGCATCTGG -3'
(R):5'- TCACTGGCAACTTTACAGCAC -3'

Sequencing Primer
(F):5'- CTGGCATCTGGAACTATGTATGAC -3'
(R):5'- GCAACTTTACAGCACTGGGC -3'

Posted On

2018-04-27