Incidental Mutation 'R6341:Lrfn5'
ID514409
Institutional Source Beutler Lab
Gene Symbol Lrfn5
Ensembl Gene ENSMUSG00000035653
Gene Nameleucine rich repeat and fibronectin type III domain containing 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6341 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location61523150-61858342 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 61843582 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 552 (Y552*)
Ref Sequence ENSEMBL: ENSMUSP00000113123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055815] [ENSMUST00000119481]
Predicted Effect probably null
Transcript: ENSMUST00000055815
AA Change: Y552*
SMART Domains Protein: ENSMUSP00000051546
Gene: ENSMUSG00000035653
AA Change: Y552*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 19 55 1.11e1 SMART
LRR 74 97 3.07e-1 SMART
LRR_TYP 98 121 1.2e-3 SMART
LRR_TYP 122 145 8.94e-3 SMART
LRR 146 169 6.58e0 SMART
LRR_TYP 170 193 8.34e-3 SMART
LRR 194 218 2.47e1 SMART
LRRCT 240 285 1.65e-2 SMART
IGc2 299 364 3.53e-13 SMART
low complexity region 393 412 N/A INTRINSIC
Blast:FN3 414 495 2e-48 BLAST
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119481
AA Change: Y552*
SMART Domains Protein: ENSMUSP00000113123
Gene: ENSMUSG00000035653
AA Change: Y552*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 19 55 1.11e1 SMART
LRR 74 97 3.07e-1 SMART
LRR_TYP 98 121 1.2e-3 SMART
LRR_TYP 122 145 8.94e-3 SMART
LRR 146 169 6.58e0 SMART
LRR_TYP 170 193 8.34e-3 SMART
LRR 194 218 2.47e1 SMART
LRRCT 240 285 1.65e-2 SMART
IGc2 299 364 3.53e-13 SMART
low complexity region 393 412 N/A INTRINSIC
Blast:FN3 414 495 2e-48 BLAST
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the leucine-rich repeat and fibronectin type III domain-containing family of proteins. A similar protein in mouse, a glycosylated transmembrane protein, is thought to function in presynaptic differentiation. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Lrfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Lrfn5 APN 12 61844126 missense probably benign
IGL02010:Lrfn5 APN 12 61839683 missense probably damaging 0.96
IGL03033:Lrfn5 APN 12 61840047 missense probably damaging 1.00
IGL03094:Lrfn5 APN 12 61839746 missense probably benign 0.00
IGL03207:Lrfn5 APN 12 61843326 missense probably damaging 1.00
falstaffian UTSW 12 61843562 missense probably benign 0.21
PIT4696001:Lrfn5 UTSW 12 61843557 missense probably damaging 1.00
R0402:Lrfn5 UTSW 12 61840017 missense probably benign 0.22
R0738:Lrfn5 UTSW 12 61840592 nonsense probably null
R0744:Lrfn5 UTSW 12 61839668 missense probably damaging 1.00
R0833:Lrfn5 UTSW 12 61839668 missense probably damaging 1.00
R0973:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R0973:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R0974:Lrfn5 UTSW 12 61843437 missense probably damaging 1.00
R1073:Lrfn5 UTSW 12 61840809 missense probably damaging 1.00
R1332:Lrfn5 UTSW 12 61857528 splice site probably benign
R1500:Lrfn5 UTSW 12 61839741 missense probably damaging 1.00
R2039:Lrfn5 UTSW 12 61840323 missense possibly damaging 0.82
R3834:Lrfn5 UTSW 12 61840030 missense probably damaging 1.00
R4171:Lrfn5 UTSW 12 61843382 missense probably damaging 1.00
R4212:Lrfn5 UTSW 12 61843820 missense probably benign
R4394:Lrfn5 UTSW 12 61843490 missense probably damaging 1.00
R4578:Lrfn5 UTSW 12 61843977 missense probably benign
R4661:Lrfn5 UTSW 12 61839647 missense probably damaging 1.00
R4730:Lrfn5 UTSW 12 61840719 missense probably benign 0.03
R4955:Lrfn5 UTSW 12 61839978 missense probably benign 0.29
R4968:Lrfn5 UTSW 12 61839675 missense probably damaging 1.00
R4970:Lrfn5 UTSW 12 61839675 missense probably damaging 1.00
R5078:Lrfn5 UTSW 12 61843874 missense possibly damaging 0.47
R5165:Lrfn5 UTSW 12 61839624 missense possibly damaging 0.89
R5768:Lrfn5 UTSW 12 61839723 missense probably benign 0.44
R5892:Lrfn5 UTSW 12 61843418 missense probably damaging 1.00
R6133:Lrfn5 UTSW 12 61843788 missense probably benign 0.22
R6211:Lrfn5 UTSW 12 61839470 missense probably benign 0.00
R6297:Lrfn5 UTSW 12 61843562 missense probably benign 0.21
R6861:Lrfn5 UTSW 12 61839690 missense probably damaging 1.00
R7179:Lrfn5 UTSW 12 61843982 missense probably benign
R7392:Lrfn5 UTSW 12 61840304 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTCAATAATCTGGCATCTGG -3'
(R):5'- TCACTGGCAACTTTACAGCAC -3'

Sequencing Primer
(F):5'- CTGGCATCTGGAACTATGTATGAC -3'
(R):5'- GCAACTTTACAGCACTGGGC -3'
Posted On2018-04-27