Incidental Mutation 'R6341:Zfp251'
ID 514414
Institutional Source Beutler Lab
Gene Symbol Zfp251
Ensembl Gene ENSMUSG00000022526
Gene Name zinc finger protein 251
Synonyms 9130001M19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R6341 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 76851609-76871435 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76854137 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 247 (H247R)
Ref Sequence ENSEMBL: ENSMUSP00000155649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080406] [ENSMUST00000229494]
AlphaFold Q6PCX8
Predicted Effect probably benign
Transcript: ENSMUST00000080406
AA Change: H252R

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079268
Gene: ENSMUSG00000022526
AA Change: H252R

DomainStartEndE-ValueType
KRAB 15 75 3.24e-32 SMART
ZnF_C2H2 202 224 3.69e-4 SMART
ZnF_C2H2 230 252 3.34e-2 SMART
ZnF_C2H2 258 280 1.69e-3 SMART
ZnF_C2H2 286 308 1.18e-2 SMART
ZnF_C2H2 314 336 4.94e-5 SMART
ZnF_C2H2 342 364 1.82e-3 SMART
ZnF_C2H2 370 392 2.71e-2 SMART
ZnF_C2H2 398 420 1.56e-2 SMART
ZnF_C2H2 426 448 1.2e-3 SMART
ZnF_C2H2 454 476 1.28e-3 SMART
ZnF_C2H2 482 504 1.3e-4 SMART
PDB:1MEY|G 551 610 2e-8 PDB
Blast:PHD 556 610 2e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000229494
AA Change: H247R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230315
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Zfp251
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Zfp251 APN 15 76854555 missense probably benign 0.33
IGL02868:Zfp251 APN 15 76854534 missense probably damaging 1.00
R0011:Zfp251 UTSW 15 76854554 missense probably benign 0.42
R0011:Zfp251 UTSW 15 76854554 missense probably benign 0.42
R1199:Zfp251 UTSW 15 76854236 missense possibly damaging 0.73
R1201:Zfp251 UTSW 15 76854236 missense possibly damaging 0.73
R1321:Zfp251 UTSW 15 76854236 missense possibly damaging 0.73
R1322:Zfp251 UTSW 15 76854236 missense possibly damaging 0.73
R1565:Zfp251 UTSW 15 76853038 missense probably damaging 0.96
R1565:Zfp251 UTSW 15 76853039 missense possibly damaging 0.81
R1587:Zfp251 UTSW 15 76870284 missense probably damaging 0.98
R1752:Zfp251 UTSW 15 76853663 missense possibly damaging 0.71
R3771:Zfp251 UTSW 15 76853636 missense possibly damaging 0.67
R3772:Zfp251 UTSW 15 76853636 missense possibly damaging 0.67
R3773:Zfp251 UTSW 15 76853636 missense possibly damaging 0.67
R4684:Zfp251 UTSW 15 76854407 missense possibly damaging 0.85
R5733:Zfp251 UTSW 15 76870327 missense probably damaging 1.00
R7050:Zfp251 UTSW 15 76854296 missense possibly damaging 0.53
R7605:Zfp251 UTSW 15 76854357 missense possibly damaging 0.53
R8783:Zfp251 UTSW 15 76853213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCTGGTGCTGAGTTAACTG -3'
(R):5'- CCCAGCCAAAGTGTTGTTACAG -3'

Sequencing Primer
(F):5'- ACACTCATCACACTTGTAGGG -3'
(R):5'- GCCAAAGTGTTGTTACAGTTCAAAG -3'
Posted On 2018-04-27