Incidental Mutation 'R6341:Efcab6'
ID514415
Institutional Source Beutler Lab
Gene Symbol Efcab6
Ensembl Gene ENSMUSG00000022441
Gene NameEF-hand calcium binding domain 6
Synonyms4931407K02Rik, 4932408N08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6341 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location83866712-84065379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 83935938 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 714 (Q714P)
Ref Sequence ENSEMBL: ENSMUSP00000114909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156187]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143592
Predicted Effect possibly damaging
Transcript: ENSMUST00000156187
AA Change: Q714P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114909
Gene: ENSMUSG00000022441
AA Change: Q714P

DomainStartEndE-ValueType
EFh 100 128 9.33e-2 SMART
low complexity region 162 172 N/A INTRINSIC
EFh 201 229 5e-2 SMART
EFh 325 353 1.59e1 SMART
EFh 532 560 1.17e2 SMART
low complexity region 598 607 N/A INTRINSIC
EFh 659 687 8.82e1 SMART
EFh 767 795 3.71e0 SMART
low complexity region 802 816 N/A INTRINSIC
EFh 909 937 2.46e-1 SMART
low complexity region 962 977 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
EFh 1090 1118 2.09e0 SMART
low complexity region 1131 1136 N/A INTRINSIC
EFh 1197 1225 2e1 SMART
Blast:EFh 1233 1261 1e-9 BLAST
EFh 1342 1370 3.48e-1 SMART
EFh 1453 1481 2.49e0 SMART
Blast:EFh 1489 1516 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163773
SMART Domains Protein: ENSMUSP00000128002
Gene: ENSMUSG00000022441

DomainStartEndE-ValueType
Blast:EFh 44 69 6e-9 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which directly binds the oncogene DJ-1 and androgen receptor to form a ternary complex in cells. This binding protein recruits histone-deacetylase complexes in order to repress transcription activity of androgen receptor. This protein may also play a role in spermatogenesis and fertilization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Efcab6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Efcab6 APN 15 84018642 missense probably benign 0.09
IGL00946:Efcab6 APN 15 84018696 missense probably benign 0.19
IGL01063:Efcab6 APN 15 84054512 start codon destroyed probably null 0.53
IGL01330:Efcab6 APN 15 84044300 missense probably benign 0.26
IGL01372:Efcab6 APN 15 84044304 missense possibly damaging 0.62
IGL01644:Efcab6 APN 15 84033072 missense probably damaging 0.97
IGL02175:Efcab6 APN 15 83896100 missense probably damaging 0.98
IGL02449:Efcab6 APN 15 84010033 missense probably benign 0.00
IGL02514:Efcab6 APN 15 84032942 missense possibly damaging 0.91
IGL02514:Efcab6 APN 15 83871311 splice site probably benign
IGL02538:Efcab6 APN 15 84054521 start gained probably benign
IGL02623:Efcab6 APN 15 83879448 missense probably damaging 0.99
IGL02735:Efcab6 APN 15 83899697 missense probably damaging 1.00
IGL03139:Efcab6 APN 15 83952221 missense probably benign 0.04
IGL03274:Efcab6 APN 15 83868249 missense probably damaging 1.00
IGL03400:Efcab6 APN 15 83867045 utr 3 prime probably benign
P0045:Efcab6 UTSW 15 83918199 missense probably damaging 1.00
PIT4445001:Efcab6 UTSW 15 83904267 missense probably benign 0.03
PIT4486001:Efcab6 UTSW 15 83973313 missense probably benign 0.00
PIT4618001:Efcab6 UTSW 15 83983446 missense probably benign 0.25
R0520:Efcab6 UTSW 15 83950046 missense probably benign 0.00
R0575:Efcab6 UTSW 15 83967700 missense probably benign 0.28
R0648:Efcab6 UTSW 15 83933064 splice site probably benign
R0894:Efcab6 UTSW 15 83918292 missense probably benign 0.00
R0975:Efcab6 UTSW 15 83973331 missense probably benign 0.00
R1238:Efcab6 UTSW 15 83933137 missense probably benign 0.06
R1625:Efcab6 UTSW 15 83947638 missense probably benign
R1651:Efcab6 UTSW 15 83870993 missense possibly damaging 0.50
R1691:Efcab6 UTSW 15 83933206 missense probably benign 0.01
R1844:Efcab6 UTSW 15 83967621 missense possibly damaging 0.47
R1929:Efcab6 UTSW 15 83892962 splice site probably benign
R1983:Efcab6 UTSW 15 83892962 splice site probably benign
R2100:Efcab6 UTSW 15 83892967 splice site probably null
R2271:Efcab6 UTSW 15 83946999 missense probably benign
R2329:Efcab6 UTSW 15 83950048 missense possibly damaging 0.90
R3618:Efcab6 UTSW 15 83950069 missense probably benign 0.00
R3687:Efcab6 UTSW 15 83871278 nonsense probably null
R3688:Efcab6 UTSW 15 83871278 nonsense probably null
R4212:Efcab6 UTSW 15 83892863 missense probably damaging 1.00
R4223:Efcab6 UTSW 15 83867108 missense probably damaging 1.00
R4459:Efcab6 UTSW 15 83904289 missense probably damaging 1.00
R4578:Efcab6 UTSW 15 83933168 missense probably benign 0.00
R4600:Efcab6 UTSW 15 83946925 missense probably benign
R5174:Efcab6 UTSW 15 84054486 missense probably benign
R5260:Efcab6 UTSW 15 83945123 missense probably benign 0.01
R5576:Efcab6 UTSW 15 83950000 missense probably benign 0.05
R5718:Efcab6 UTSW 15 83904238 missense probably damaging 1.00
R5797:Efcab6 UTSW 15 83924277 missense possibly damaging 0.82
R6027:Efcab6 UTSW 15 83967721 missense probably benign
R6110:Efcab6 UTSW 15 83879634 missense possibly damaging 0.69
R6132:Efcab6 UTSW 15 84032972 missense probably damaging 1.00
R6166:Efcab6 UTSW 15 83896115 missense probably benign 0.01
R6228:Efcab6 UTSW 15 83967624 missense possibly damaging 0.67
R6445:Efcab6 UTSW 15 83868357 missense probably damaging 1.00
R6494:Efcab6 UTSW 15 84044322 critical splice acceptor site probably null
R6611:Efcab6 UTSW 15 83892835 missense possibly damaging 0.68
R7392:Efcab6 UTSW 15 83988951 missense probably benign 0.39
R7599:Efcab6 UTSW 15 83870988 missense probably damaging 1.00
R7711:Efcab6 UTSW 15 83949924 missense probably benign 0.00
R7873:Efcab6 UTSW 15 84018625 critical splice donor site probably null
R8031:Efcab6 UTSW 15 83983498 missense possibly damaging 0.90
R8075:Efcab6 UTSW 15 83967623 missense probably damaging 0.99
R8209:Efcab6 UTSW 15 83904255 missense probably benign 0.04
R8226:Efcab6 UTSW 15 83904255 missense probably benign 0.04
R8710:Efcab6 UTSW 15 84018648 missense probably benign 0.00
X0019:Efcab6 UTSW 15 83879483 missense possibly damaging 0.92
X0064:Efcab6 UTSW 15 83983493 missense probably benign 0.08
Z1088:Efcab6 UTSW 15 83955009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATCAACTCTGAGTCTGTAGTC -3'
(R):5'- AGCCTTGCAGAAGAGCAGTG -3'

Sequencing Primer
(F):5'- GAGTCTGTAGTCCGTTCACAAAGTC -3'
(R):5'- CTTGCAGAAGAGCAGTGGCATC -3'
Posted On2018-04-27