Incidental Mutation 'R6341:Rogdi'
ID 514416
Institutional Source Beutler Lab
Gene Symbol Rogdi
Ensembl Gene ENSMUSG00000022540
Gene Name rogdi homolog
Synonyms 0610011C19Rik, Lzf
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R6341 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 5008730-5013553 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 5013377 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023189] [ENSMUST00000023191] [ENSMUST00000090453] [ENSMUST00000115844] [ENSMUST00000201077] [ENSMUST00000202281]
AlphaFold Q3TDK6
Predicted Effect probably benign
Transcript: ENSMUST00000023189
SMART Domains Protein: ENSMUSP00000023189
Gene: ENSMUSG00000022536

DomainStartEndE-ValueType
Pfam:PWWP 6 89 1.4e-24 PFAM
low complexity region 109 122 N/A INTRINSIC
AT_hook 167 179 3.21e-1 SMART
Pfam:NAD_binding_2 266 422 1.2e-36 PFAM
Pfam:F420_oxidored 268 355 2e-6 PFAM
Pfam:NAD_binding_11 423 544 2.7e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000023191
SMART Domains Protein: ENSMUSP00000023191
Gene: ENSMUSG00000022540

DomainStartEndE-ValueType
Pfam:Rogdi_lz 18 298 9.7e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000090453
SMART Domains Protein: ENSMUSP00000087938
Gene: ENSMUSG00000022540

DomainStartEndE-ValueType
Pfam:Rogdi_lz 18 210 1.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115844
SMART Domains Protein: ENSMUSP00000111510
Gene: ENSMUSG00000022536

DomainStartEndE-ValueType
Pfam:PWWP 6 89 1.8e-24 PFAM
low complexity region 109 122 N/A INTRINSIC
AT_hook 167 179 3.21e-1 SMART
Pfam:NAD_binding_2 266 428 2.6e-41 PFAM
Pfam:F420_oxidored 268 361 3.2e-9 PFAM
Pfam:NAD_binding_11 429 550 3.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201077
AA Change: Q9K

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144166
Gene: ENSMUSG00000022540
AA Change: Q9K

DomainStartEndE-ValueType
Pfam:Rogdi_lz 12 134 7.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201726
Predicted Effect probably null
Transcript: ENSMUST00000202281
SMART Domains Protein: ENSMUSP00000144481
Gene: ENSMUSG00000022540

DomainStartEndE-ValueType
Pfam:Rogdi_lz 18 276 4.4e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202998
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. Loss-of-function mutation in this gene cause Kohlschutter-Tonz syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Rogdi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02393:Rogdi APN 16 5009224 missense probably benign 0.00
R1778:Rogdi UTSW 16 5010505 missense probably benign 0.38
R2973:Rogdi UTSW 16 5011662 missense probably damaging 1.00
R2974:Rogdi UTSW 16 5011662 missense probably damaging 1.00
R4753:Rogdi UTSW 16 5010499 missense probably damaging 0.99
R5340:Rogdi UTSW 16 5013361 missense probably benign 0.32
R5893:Rogdi UTSW 16 5013394 nonsense probably null
R5976:Rogdi UTSW 16 5013311 missense probably benign 0.11
R7069:Rogdi UTSW 16 5013498 unclassified probably benign
R7709:Rogdi UTSW 16 5009234 missense probably damaging 1.00
R8170:Rogdi UTSW 16 5011737 missense probably benign
R8313:Rogdi UTSW 16 5013449 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTGTGTAATTACATGCCAGC -3'
(R):5'- AGCTCCTGACTACAGACCTC -3'

Sequencing Primer
(F):5'- GCGTCTGAACTGTACTCTCAGAAG -3'
(R):5'- CTACAGACCTCAGAGACGGTG -3'
Posted On 2018-04-27