Mutagenetix > Incidental Mutations

Incidental Mutation 'R6341:Hlcs'

514420

Institutional Source

Beutler Lab

Gene Symbol

Hlcs

Ensembl Gene

ENSMUSG00000040820

Gene Name

holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)

Synonyms

D16Jhu34, 410I21.SP6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6341 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

94128882-94313571 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94231163 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 52 (F52S)

Ref Sequence

ENSEMBL: ENSMUSP00000154157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099512] [ENSMUST00000163193] [ENSMUST00000227141] [ENSMUST00000228910]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099512
AA Change: F447S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097112
Gene: ENSMUSG00000040820
AA Change: F447S

Domain	Start	End	E-Value	Type
low complexity region	38	55	N/A	INTRINSIC
low complexity region	377	391	N/A	INTRINSIC
Pfam:BPL_LplA_LipB	467	599	1.9e-21	PFAM
Pfam:BPL_C	665	714	3.7e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163193
AA Change: F447S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130981
Gene: ENSMUSG00000040820
AA Change: F447S

Domain	Start	End	E-Value	Type
low complexity region	38	55	N/A	INTRINSIC
low complexity region	377	391	N/A	INTRINSIC
Pfam:BPL_LplA_LipB	467	599	3.6e-30	PFAM
Pfam:BPL_C	665	714	4.9e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226776

Predicted Effect

probably damaging
Transcript: ENSMUST00000227141
AA Change: F594S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000228910
AA Change: F52S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the binding of biotin to carboxylases and histones. The protein plays an important role in gluconeogenesis, fatty acid synthesis and branched chain amino acid catabolism. Defects in this gene are the cause of holocarboxylase synthetase deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jun 2011]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	T	C	16: 31,105,546	D658G	possibly damaging	Het
Amz2	A	G	11: 109,428,827	H13R	probably benign	Het
Ankrd27	G	T	7: 35,627,403		probably null	Het
Atp8a1	T	C	5: 67,682,927	T704A	possibly damaging	Het
Cabin1	A	T	10: 75,658,739	M1602K	probably damaging	Het
Ccdc74a	T	C	16: 17,648,114	S105P	probably damaging	Het
Cdh26	T	A	2: 178,471,573		probably null	Het
Cxcl10	T	C	5: 92,348,213	I22V	probably benign	Het
Cyp2c68	A	C	19: 39,712,489	V295G	possibly damaging	Het
Ddx10	A	T	9: 53,204,251	D594E	probably benign	Het
Ddx5	T	C	11: 106,785,542		probably null	Het
Ddx58	T	A	4: 40,222,199		probably null	Het
Duox1	T	C	2: 122,337,721	I1109T	probably damaging	Het
Dusp15	T	C	2: 152,946,284		probably null	Het
Ecel1	A	G	1: 87,150,471		probably null	Het
Efcab6	T	G	15: 83,935,938	Q714P	possibly damaging	Het
Erc1	A	G	6: 119,777,998	L464P	possibly damaging	Het
Fam129c	C	T	8: 71,600,077	P65L	probably damaging	Het
Fam234a	T	A	17: 26,213,693	H494L	probably damaging	Het
Gfpt1	T	C	6: 87,088,145	V694A	probably damaging	Het
Gli2	T	C	1: 118,836,224	D1399G	probably damaging	Het
Gm10110	T	C	14: 89,896,708		noncoding transcript	Het
Hdac3	A	G	18: 37,944,164	L219P	probably damaging	Het
Ints7	C	A	1: 191,613,127	T643K	probably damaging	Het
Ireb2	A	G	9: 54,908,780	I878M	probably damaging	Het
Itga3	A	T	11: 95,055,851		probably null	Het
Lrfn5	T	A	12: 61,843,582	Y552*	probably null	Het
Mafb	T	C	2: 160,366,451	T76A	probably damaging	Het
Man2b1	A	T	8: 85,095,399	S748C	probably damaging	Het
Mmp15	G	T	8: 95,365,463		probably null	Het
Mmp17	A	T	5: 129,601,955	R335W	probably damaging	Het
Muc5ac	A	T	7: 141,801,492	D1005V	probably damaging	Het
Myh3	T	C	11: 67,082,996	F165S	probably benign	Het
Nacc1	T	C	8: 84,674,791	D419G	probably benign	Het
Neb	G	A	2: 52,209,474	S4545L	probably damaging	Het
Npas2	T	C	1: 39,300,687	I106T	probably damaging	Het
Ogfrl1	T	G	1: 23,369,863	K427N	probably benign	Het
Olfr1448	T	C	19: 12,919,479	T277A	probably benign	Het
Pde4dip	T	A	3: 97,694,911	Q2283L	probably benign	Het
Phax	C	T	18: 56,573,101	T21M	possibly damaging	Het
Pitpnm1	A	T	19: 4,102,829	K79*	probably null	Het
Pkd1	T	A	17: 24,580,227	F2807I	probably damaging	Het
Plekha4	C	T	7: 45,541,148	R427C	probably damaging	Het
Ptprj	A	T	2: 90,458,349	F757L	probably benign	Het
Rad1	A	G	15: 10,492,821	D208G	probably damaging	Het
Rangrf	T	A	11: 68,972,712	N156I	probably benign	Het
Rasl11b	T	C	5: 74,198,376	S181P	probably damaging	Het
Rlf	G	A	4: 121,149,360	Q808*	probably null	Het
Rogdi	G	T	16: 5,013,377		probably null	Het
Sec24a	A	T	11: 51,717,776	V573D	probably damaging	Het
Sorbs2	A	G	8: 45,770,578	T200A	probably damaging	Het
Srgap2	C	T	1: 131,291,629	R259H	probably benign	Het
Ssc5d	T	A	7: 4,936,665	V700E	probably benign	Het
Stt3a	A	T	9: 36,751,296	H222Q	probably damaging	Het
Tcaf3	A	T	6: 42,597,259	D6E	possibly damaging	Het
Tdrd12	C	T	7: 35,490,048	R421H	probably damaging	Het
Top3b	T	C	16: 16,879,071	M62T	probably damaging	Het
Trhr	T	G	15: 44,229,298	Y310*	probably null	Het
Urb2	G	T	8: 124,031,125	E1190D	probably damaging	Het
Usp34	A	G	11: 23,381,353	T1085A	probably damaging	Het
Vmn1r179	T	A	7: 23,929,066	H227Q	possibly damaging	Het
Vmn1r31	A	T	6: 58,472,010	M290K	probably benign	Het
Wdr75	T	C	1: 45,802,131		probably null	Het
Wnk1	A	T	6: 119,948,585	V1306D	probably damaging	Het
Xkr4	T	C	1: 3,670,778	T191A	probably benign	Het
Zc3h15	A	G	2: 83,661,223	E265G	probably benign	Het
Zcchc9	A	G	13: 91,800,697	F41S	possibly damaging	Het
Zfp251	T	C	15: 76,854,137	H247R	probably damaging	Het
Zfp433	A	G	10: 81,720,123	E152G	probably damaging	Het
Zfp770	A	T	2: 114,196,759	S276R	probably benign	Het

Other mutations in Hlcs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01078:Hlcs	APN	16	94133160	missense	probably damaging	0.99
IGL02026:Hlcs	APN	16	94134705	missense	probably damaging	0.99
IGL02341:Hlcs	APN	16	94231110	missense	probably damaging	0.99
IGL03075:Hlcs	APN	16	94138847	missense	probably damaging	1.00
PIT4515001:Hlcs	UTSW	16	94267416	missense	probably benign	0.45
R0372:Hlcs	UTSW	16	94138907	missense	possibly damaging	0.69
R0664:Hlcs	UTSW	16	94231311	missense	probably damaging	1.00
R0731:Hlcs	UTSW	16	94131852	missense	probably damaging	1.00
R1465:Hlcs	UTSW	16	94268292	missense	probably damaging	0.99
R1465:Hlcs	UTSW	16	94268292	missense	probably damaging	0.99
R1761:Hlcs	UTSW	16	94268007	missense	probably benign	0.05
R2013:Hlcs	UTSW	16	94262740	missense	probably benign	0.17
R2014:Hlcs	UTSW	16	94262740	missense	probably benign	0.17
R2015:Hlcs	UTSW	16	94262740	missense	probably benign	0.17
R2204:Hlcs	UTSW	16	94231152	missense	probably benign	0.30
R2371:Hlcs	UTSW	16	94268067	missense	probably damaging	0.98
R3816:Hlcs	UTSW	16	94133088	missense	probably benign	0.11
R3822:Hlcs	UTSW	16	94267981	missense	probably benign	0.04
R4422:Hlcs	UTSW	16	94138960	missense	possibly damaging	0.56
R4657:Hlcs	UTSW	16	94262698	missense	probably benign	0.00
R4783:Hlcs	UTSW	16	94268539	missense	possibly damaging	0.82
R5347:Hlcs	UTSW	16	94267524	missense	possibly damaging	0.93
R5808:Hlcs	UTSW	16	94262632	missense	probably benign	0.00
R5940:Hlcs	UTSW	16	94134712	missense	probably damaging	0.99
R6943:Hlcs	UTSW	16	94141402	missense	possibly damaging	0.75
R7053:Hlcs	UTSW	16	94268015	missense	possibly damaging	0.91
R7157:Hlcs	UTSW	16	94268164	nonsense	probably null
R7166:Hlcs	UTSW	16	94262726	missense	possibly damaging	0.92
R7313:Hlcs	UTSW	16	94267503	missense	probably damaging	1.00
R7427:Hlcs	UTSW	16	94267899	missense	probably benign	0.00
R7428:Hlcs	UTSW	16	94267899	missense	probably benign	0.00
R7547:Hlcs	UTSW	16	94231172	nonsense	probably null
R7548:Hlcs	UTSW	16	94133017	nonsense	probably null
R8172:Hlcs	UTSW	16	94267626	missense	probably damaging	1.00
R8241:Hlcs	UTSW	16	94267818	missense	probably damaging	1.00
R8500:Hlcs	UTSW	16	94262758	missense	possibly damaging	0.89
X0065:Hlcs	UTSW	16	94133173	missense	probably damaging	1.00
Z1176:Hlcs	UTSW	16	94262659	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATGATGGGCAGACCTGTC -3'
(R):5'- GTGGCTTAAACCTCAACTTATCAGTC -3'

Sequencing Primer
(F):5'- GTCCCTTCTGCCTGGGTACAG -3'
(R):5'- AAACCTCAACTTATCAGTCTGTCC -3'

Posted On

2018-04-27