Incidental Mutation 'R6341:Hlcs'
ID514420
Institutional Source Beutler Lab
Gene Symbol Hlcs
Ensembl Gene ENSMUSG00000040820
Gene Nameholocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
SynonymsD16Jhu34, 410I21.SP6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6341 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location94128882-94313571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94231163 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 52 (F52S)
Ref Sequence ENSEMBL: ENSMUSP00000154157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099512] [ENSMUST00000163193] [ENSMUST00000227141] [ENSMUST00000228910]
Predicted Effect probably damaging
Transcript: ENSMUST00000099512
AA Change: F447S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097112
Gene: ENSMUSG00000040820
AA Change: F447S

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
Pfam:BPL_LplA_LipB 467 599 1.9e-21 PFAM
Pfam:BPL_C 665 714 3.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163193
AA Change: F447S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130981
Gene: ENSMUSG00000040820
AA Change: F447S

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
Pfam:BPL_LplA_LipB 467 599 3.6e-30 PFAM
Pfam:BPL_C 665 714 4.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226776
Predicted Effect probably damaging
Transcript: ENSMUST00000227141
AA Change: F594S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228910
AA Change: F52S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the binding of biotin to carboxylases and histones. The protein plays an important role in gluconeogenesis, fatty acid synthesis and branched chain amino acid catabolism. Defects in this gene are the cause of holocarboxylase synthetase deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hdac3 A G 18: 37,944,164 L219P probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Hlcs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01078:Hlcs APN 16 94133160 missense probably damaging 0.99
IGL02026:Hlcs APN 16 94134705 missense probably damaging 0.99
IGL02341:Hlcs APN 16 94231110 missense probably damaging 0.99
IGL03075:Hlcs APN 16 94138847 missense probably damaging 1.00
PIT4515001:Hlcs UTSW 16 94267416 missense probably benign 0.45
R0372:Hlcs UTSW 16 94138907 missense possibly damaging 0.69
R0664:Hlcs UTSW 16 94231311 missense probably damaging 1.00
R0731:Hlcs UTSW 16 94131852 missense probably damaging 1.00
R1465:Hlcs UTSW 16 94268292 missense probably damaging 0.99
R1465:Hlcs UTSW 16 94268292 missense probably damaging 0.99
R1761:Hlcs UTSW 16 94268007 missense probably benign 0.05
R2013:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2014:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2015:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2204:Hlcs UTSW 16 94231152 missense probably benign 0.30
R2371:Hlcs UTSW 16 94268067 missense probably damaging 0.98
R3816:Hlcs UTSW 16 94133088 missense probably benign 0.11
R3822:Hlcs UTSW 16 94267981 missense probably benign 0.04
R4422:Hlcs UTSW 16 94138960 missense possibly damaging 0.56
R4657:Hlcs UTSW 16 94262698 missense probably benign 0.00
R4783:Hlcs UTSW 16 94268539 missense possibly damaging 0.82
R5347:Hlcs UTSW 16 94267524 missense possibly damaging 0.93
R5808:Hlcs UTSW 16 94262632 missense probably benign 0.00
R5940:Hlcs UTSW 16 94134712 missense probably damaging 0.99
R6943:Hlcs UTSW 16 94141402 missense possibly damaging 0.75
R7053:Hlcs UTSW 16 94268015 missense possibly damaging 0.91
R7157:Hlcs UTSW 16 94268164 nonsense probably null
R7166:Hlcs UTSW 16 94262726 missense possibly damaging 0.92
R7313:Hlcs UTSW 16 94267503 missense probably damaging 1.00
R7427:Hlcs UTSW 16 94267899 missense probably benign 0.00
R7428:Hlcs UTSW 16 94267899 missense probably benign 0.00
R7547:Hlcs UTSW 16 94231172 nonsense probably null
R7548:Hlcs UTSW 16 94133017 nonsense probably null
R8172:Hlcs UTSW 16 94267626 missense probably damaging 1.00
R8241:Hlcs UTSW 16 94267818 missense probably damaging 1.00
R8500:Hlcs UTSW 16 94262758 missense possibly damaging 0.89
X0065:Hlcs UTSW 16 94133173 missense probably damaging 1.00
Z1176:Hlcs UTSW 16 94262659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGATGGGCAGACCTGTC -3'
(R):5'- GTGGCTTAAACCTCAACTTATCAGTC -3'

Sequencing Primer
(F):5'- GTCCCTTCTGCCTGGGTACAG -3'
(R):5'- AAACCTCAACTTATCAGTCTGTCC -3'
Posted On2018-04-27