Incidental Mutation 'R6341:Hdac3'
ID514423
Institutional Source Beutler Lab
Gene Symbol Hdac3
Ensembl Gene ENSMUSG00000024454
Gene Namehistone deacetylase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6341 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37935844-37954988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37944164 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 219 (L219P)
Ref Sequence ENSEMBL: ENSMUSP00000037981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043498]
Predicted Effect probably damaging
Transcript: ENSMUST00000043498
AA Change: L219P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037981
Gene: ENSMUSG00000024454
AA Change: L219P

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 11 315 1.2e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153945
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene results in embryonic death at or around the time of gastrulation. Structural and functional abnormalities are also reported in mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,105,546 D658G possibly damaging Het
Amz2 A G 11: 109,428,827 H13R probably benign Het
Ankrd27 G T 7: 35,627,403 probably null Het
Atp8a1 T C 5: 67,682,927 T704A possibly damaging Het
Cabin1 A T 10: 75,658,739 M1602K probably damaging Het
Ccdc74a T C 16: 17,648,114 S105P probably damaging Het
Cdh26 T A 2: 178,471,573 probably null Het
Cxcl10 T C 5: 92,348,213 I22V probably benign Het
Cyp2c68 A C 19: 39,712,489 V295G possibly damaging Het
Ddx10 A T 9: 53,204,251 D594E probably benign Het
Ddx5 T C 11: 106,785,542 probably null Het
Ddx58 T A 4: 40,222,199 probably null Het
Duox1 T C 2: 122,337,721 I1109T probably damaging Het
Dusp15 T C 2: 152,946,284 probably null Het
Ecel1 A G 1: 87,150,471 probably null Het
Efcab6 T G 15: 83,935,938 Q714P possibly damaging Het
Erc1 A G 6: 119,777,998 L464P possibly damaging Het
Fam129c C T 8: 71,600,077 P65L probably damaging Het
Fam234a T A 17: 26,213,693 H494L probably damaging Het
Gfpt1 T C 6: 87,088,145 V694A probably damaging Het
Gli2 T C 1: 118,836,224 D1399G probably damaging Het
Gm10110 T C 14: 89,896,708 noncoding transcript Het
Hlcs A G 16: 94,231,163 F52S probably damaging Het
Ints7 C A 1: 191,613,127 T643K probably damaging Het
Ireb2 A G 9: 54,908,780 I878M probably damaging Het
Itga3 A T 11: 95,055,851 probably null Het
Lrfn5 T A 12: 61,843,582 Y552* probably null Het
Mafb T C 2: 160,366,451 T76A probably damaging Het
Man2b1 A T 8: 85,095,399 S748C probably damaging Het
Mmp15 G T 8: 95,365,463 probably null Het
Mmp17 A T 5: 129,601,955 R335W probably damaging Het
Muc5ac A T 7: 141,801,492 D1005V probably damaging Het
Myh3 T C 11: 67,082,996 F165S probably benign Het
Nacc1 T C 8: 84,674,791 D419G probably benign Het
Neb G A 2: 52,209,474 S4545L probably damaging Het
Npas2 T C 1: 39,300,687 I106T probably damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 T C 19: 12,919,479 T277A probably benign Het
Pde4dip T A 3: 97,694,911 Q2283L probably benign Het
Phax C T 18: 56,573,101 T21M possibly damaging Het
Pitpnm1 A T 19: 4,102,829 K79* probably null Het
Pkd1 T A 17: 24,580,227 F2807I probably damaging Het
Plekha4 C T 7: 45,541,148 R427C probably damaging Het
Ptprj A T 2: 90,458,349 F757L probably benign Het
Rad1 A G 15: 10,492,821 D208G probably damaging Het
Rangrf T A 11: 68,972,712 N156I probably benign Het
Rasl11b T C 5: 74,198,376 S181P probably damaging Het
Rlf G A 4: 121,149,360 Q808* probably null Het
Rogdi G T 16: 5,013,377 probably null Het
Sec24a A T 11: 51,717,776 V573D probably damaging Het
Sorbs2 A G 8: 45,770,578 T200A probably damaging Het
Srgap2 C T 1: 131,291,629 R259H probably benign Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tcaf3 A T 6: 42,597,259 D6E possibly damaging Het
Tdrd12 C T 7: 35,490,048 R421H probably damaging Het
Top3b T C 16: 16,879,071 M62T probably damaging Het
Trhr T G 15: 44,229,298 Y310* probably null Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp34 A G 11: 23,381,353 T1085A probably damaging Het
Vmn1r179 T A 7: 23,929,066 H227Q possibly damaging Het
Vmn1r31 A T 6: 58,472,010 M290K probably benign Het
Wdr75 T C 1: 45,802,131 probably null Het
Wnk1 A T 6: 119,948,585 V1306D probably damaging Het
Xkr4 T C 1: 3,670,778 T191A probably benign Het
Zc3h15 A G 2: 83,661,223 E265G probably benign Het
Zcchc9 A G 13: 91,800,697 F41S possibly damaging Het
Zfp251 T C 15: 76,854,137 H247R probably damaging Het
Zfp433 A G 10: 81,720,123 E152G probably damaging Het
Zfp770 A T 2: 114,196,759 S276R probably benign Het
Other mutations in Hdac3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Hdac3 APN 18 37954885 missense possibly damaging 0.95
IGL00570:Hdac3 APN 18 37944121 splice site probably benign
IGL01511:Hdac3 APN 18 37952595 missense probably benign 0.16
IGL01559:Hdac3 APN 18 37943672 splice site probably benign
IGL01688:Hdac3 APN 18 37954879 missense possibly damaging 0.53
IGL02529:Hdac3 APN 18 37944132 missense probably benign 0.20
IGL02559:Hdac3 APN 18 37954891 missense probably damaging 1.00
IGL02702:Hdac3 APN 18 37941094 missense probably benign 0.00
PIT4520001:Hdac3 UTSW 18 37941764 missense probably damaging 1.00
R0173:Hdac3 UTSW 18 37941753 missense probably damaging 0.97
R0325:Hdac3 UTSW 18 37940952 critical splice donor site probably null
R0445:Hdac3 UTSW 18 37943724 missense probably damaging 0.99
R1341:Hdac3 UTSW 18 37954713 missense probably damaging 1.00
R2068:Hdac3 UTSW 18 37943516 missense probably damaging 1.00
R2761:Hdac3 UTSW 18 37945726 missense probably benign 0.19
R3805:Hdac3 UTSW 18 37945692 critical splice donor site probably null
R4467:Hdac3 UTSW 18 37952513 missense probably benign 0.03
R5928:Hdac3 UTSW 18 37941341 intron probably benign
R5929:Hdac3 UTSW 18 37941341 intron probably benign
R6679:Hdac3 UTSW 18 37944933 missense possibly damaging 0.59
R6843:Hdac3 UTSW 18 37941954 missense probably benign
R7262:Hdac3 UTSW 18 37945563 missense probably damaging 0.99
R7559:Hdac3 UTSW 18 37945516 missense possibly damaging 0.94
R7585:Hdac3 UTSW 18 37945355 missense probably damaging 1.00
R7652:Hdac3 UTSW 18 37954919 unclassified probably benign
R8434:Hdac3 UTSW 18 37941422 missense possibly damaging 0.68
Z1177:Hdac3 UTSW 18 37945751 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTGTTACAACTGCCAAG -3'
(R):5'- CATTCTTTGTCTATTGCTACAGACCAG -3'

Sequencing Primer
(F):5'- CAAATTCCAAGGGTTCATGGTCC -3'
(R):5'- CCTGGGTAATGCAACAAGTTCCTG -3'
Posted On2018-04-27